Labshake search
Citations for New England Biolabs :
851 - 900 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 x concentrated Phusion HF buffer and 1 U Phusion DNA Polymerase (New England Biolabs). The PCR reaction was performed as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 ng/μl of template DNA and 1 U of Phusion polymerase (New England Biolabs). The mutant PCR fragments were then cloned into pSpurMS2 (a gift from Dr ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were visualized on 1% agarose gels with a 1 kb plus ladder (NEB).
-
bioRxiv - Biochemistry 2023Quote: ... with 1 μg RNA and 1 unit RNase Inhibitor (New England Biolabs Inc., Massachusetts, USA), 5 μg methyltransferase or no enzyme ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM EDTA] plus 1 µL 20 µg/µL lambda phage DNA (NEB, cat # N3011S) and was separated on a 6% polyacrylamide / 0.5x TBE / 1.5 mm gel for 2 hr at 110 V in a Novex electrophoresis system ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Microbiology 2024Quote: ... the ExoI reaction mixture containing 1 x ExoI buffer and 1 U/μL ExoI (NEB) enzyme was prepared ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg μl-1 bovine serum albumin (New England Biolabs® Inc., Ipswich, MA, USA), 0.2 μM of each primer and 2 μl of template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Genomics 2022Quote: ... we use the methyl sensitive endonuclease ApeKI (NEB R0643L) in order to minimize the repetitive fraction sampled ...
-
bioRxiv - Genomics 2023Quote: ... 500 mM each of 50-methyl-dCTP (NEB N0356S), dATP ...
-
bioRxiv - Microbiology 2021Quote: ... was ligated with the digested vector in a ratio of 3:1 using the Gibson assembly ligation matrix mix (NEB E5510S). Each ligation reaction was incubated for 1 hour at 50 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... of unc-3 and lin-39 were amplified and then ligated to cholinergic (cho-1, unc-3) or GABAergic (unc-47) promoters using Gibson Assembly Cloning Kit (NEB #5510S). For unc-3 RNAi ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 100 μM PvG748-SBS12-RT random hexamer primer (Supplementary Table 3) and 1 μl of 10 mM dNTP mix (NEB, N0447S), incubated for 3 minutes at 65 °C and transferred to ice ...
-
bioRxiv - Cell Biology 2022Quote: ... TSF-ATG101:ATG13 (1-197) complex (final 3 μM) were incubated with 30 μl Amylose resin (New England Biolabs, Ipswich, MA) at 4 °C overnight in the ITC buffer ...
-
bioRxiv - Genomics 2022Quote: ... The RNA was removed from beads by Trizol and then followed with the 3’ adapter ligation using T4 RNA Ligase 1 (NEB M0204L). After this ...
-
bioRxiv - Genomics 2022Quote: ... the SapI sgRNA expression cassette was ligated into the KpnI linearized PX458 in a 3:1 molarity ratio using T4 DNA-ligase (New England Biolabs, M0202S) according to the manufacturer’s instructions followed by transformation and Sanger sequencing to verify successful cloning ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The ligation was performed at a 3:1 insert-to-vector ratio and by using T4 DNA ligase (New England Biolabs, USA) for 16 hours at 16 °C according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from HeLa cells co-transfected with mGFP-Sec16L at 3 µg/µL and FLAG-TFG-SNAP at 1 µg/µL and subsequently labeled with SNAP-Cell 647-SiR (NEB, S9102S) and immunostained with anti-GM130 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Filtered (0.45 μm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...