Labshake search
Citations for New England Biolabs :
51 - 100 of 6947 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Dual-indexing was carried out with the TruSeq panel of indexing primers in a short-cycle PCR using Luna Universal Probe One-Step RT-qPCR reagents (NEB). The pooled adapter libraries were purified and size-selected using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... Excess RT primers were removed with exonuclease I (M0293S, NEB), and the cDNAs were size-selected (120-220 nt ...
-
bioRxiv - Molecular Biology 2019Quote: ... primed by primer SR-RT (NEB, sequence see Table S4) complementary to the 3’ DNA adaptor ...
-
bioRxiv - Bioengineering 2024Quote: ... The LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA per manufacturer protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... were used as templates for 24 cycles 50 μl PCR reactions using a distinct set of barcoded primers (0.5 μM each primer) for each reaction and Phusion High Fidelity DNA polymerase (NEB) with a maximum polymerase concentration ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... OneTaq RT-PCR mix (NEB #E5315) was used to amplify the generated cDNA.
-
bioRxiv - Cancer Biology 2021Quote: ... and the NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB: E7335L). Samples with total RNA concentration of >10 ng/µl (0.5 µg total amount ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) by NEB following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... but with NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 (NEB). Barcoded amplicons were then purified with AMPure XP magnetic beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB, E7600S), and an Illumina NextSeq 550 75 cycle high-output kit (Illumina ...
-
bioRxiv - Systems Biology 2021Quote: ... NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB E7600S), and an Illumina NextSeq 550 75 cycle high-output kit (Illumina 20024906) ...
-
bioRxiv - Systems Biology 2023Quote: ... NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB EE7600S), and an Illumina NextSeq 550 75-cycle high-output kit (Illumina #20024906) ...
-
bioRxiv - Cancer Biology 2023Quote: ... NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB E7600S) was used for assigning indices to all samples prior to pooling ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) by NEB following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... with NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 (NEB, #E7600S) with primer indexing PCR run according to the Epicypher protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified product was amplified with distinct NEBNext dual index primer sets (NEB, E7600S) for 6 cycles with Q5 polymerase in 50uL reactions.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Bioengineering 2023Quote: ... Specific donor sequences for small edits were encoded in primers and substituted into the RT-DNA-encoding region of the ncRNA with a PCR and KLD reaction (NEB M0554). Donor sequences for larger insertions were cloned through Gibson assembly ...
-
bioRxiv - Genomics 2023Quote: ... Universal PCR Primer for Illumina and index primer for Illumina (NEB E7335S), and 2X Kapa HiFi HotStart ReadyMix (Kapa KK2611) ...
-
bioRxiv - Genomics 2023Quote: ... Universal PCR Primer for Illumina and index primer for Illumina (NEB E7335S), and 2X Kapa HiFi HotStart ReadyMix (Kapa KK2611) ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-cycle PCR with index primers (NEB) was performed (initial denaturation ...
-
bioRxiv - Evolutionary Biology 2021Quote: Hybridization with the reverse transcription primers was performed by adding 1 uL of SR RT Primer (NEB E7333A) to the above reaction and incubating at 75 C for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) (NEB E7335) according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... and the NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs) were used as specified by the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1) (E7335; NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440). The generated DNA libraries were purified using Agencourt® AMPure® XP (Beckman Coulter) ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Developmental Biology 2020Quote: ... The amplification of V3-V4 hypervariable region of the 16S rRNA gene was carried out with formwork of each of the DNA samples using the primer set 515F/806R and Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, United States) as described by Caporaso et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 25 µL PCR were set up with 1X PCR Buffer (NEB, Ipswich, MA, USA) containing 1.5 mM MgCl2 ...
-
bioRxiv - Genomics 2020Quote: ... were combined with RT primer mix [1 μl 250 ng/μl randomhexRT primer and 0.5 μl 10 mM dNTPs (NEB)] ...
-
bioRxiv - Genomics 2023Quote: ... The flanking sequence of rs2248374 was amplified by PCR (Forward primer: AGGGAAAGAGAAGAATTGGA; Reverse primer: TCTCTTTCCTGTAGTGATTC) and PCR products incubated with the TaqI-v2 (R0149S, New England Biolabs) restriction enzyme (15 min at 65 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (NEB #E7600) (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were dual-indexed using 12 cycles of PCR amplification using NEBNext® Multiplex Oligos for Illumina® Dual Index Primer Set (New England Biolabs, Inc., Cat. No. E7600). Library quality control was performed by measuring concentration with Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Genomics 2022Quote: Real-time PCR (RT-PCR) amplification of RNA was performed following the Luna Universal One-Step RT-qPCR kit (New England Biolabs). A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: RT-PCR was completed using Taq DNA polymerase (Taq PCR kit, NEB), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR with OneTaq (New England Biolabs #M0480S) was performed on cDNA preparations ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Genomics 2023Quote: ... with different NEB-Next index primers and the NEB-Next Universal PCR Primer (NEB #E6861A) with three PCR cycles for MNAse samples or eight PCR cycles for ChIp samples ...
-
bioRxiv - Genomics 2020Quote: ... and barcoded with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs). We sequenced prepared libraries on an Illumina MiSeq using MiSeq Reagent Kit v3 (2×300 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... and indexed with NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set I; New England Biolabs). Libraries were assessed for quality on a capillary electrophoresis instrument (AATI Fragment Analyzer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and indexed with NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set I) (New England Biolabs). Library quality was checked on the Fragment Analyzer and sequenced on a Illumina Hiseq 2500 on SR100 mode.
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Bioengineering 2023Quote: ... we used the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) oligos (NEB E7600S). All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906 ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...