Labshake search
Citations for New England Biolabs :
1 - 50 of 6947 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: pGRNA-sacB-endA was cloned by PCR-amplification of pGRNA-sacB-ccdB using primers 542 and 543 and subsequent circularization of the PCR product by Gibson assembly (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... bulk-extracted genomic DNA from these strains was used to set up PCR reactions for each primer set using Quick Load Taq 2X Master Mix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer Set 1 (New England Biolabs). Libraries were sequenced on an Illumina HiSeq 2500 instrument using 50-bp single-end reads.
-
bioRxiv - Neuroscience 2022Quote: ... Primer Set 1 (New England Biolabs). Libraries were sequenced on an Illumina HiSeq 2500 instrument using 50-bp single-end reads.
-
bioRxiv - Cell Biology 2020Quote: ... Index Primers Set 1 (New England Biolabs). P5/P7 PCR fragments were purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with index primer set 1 (NEB #7335S) and set 2 (NEB #7500S ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sets used were designed by Primer 6 (PREMIER Biosoft Biolabs) (Appendix Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Systems Biology 2023Quote: ... primers of the NEBNext dual primer set 1 (New England Biolabs, Ipswitch, MA) were used ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification was performed using the QUILLS primer set and Q5® High-Fidelity DNA Polymerase (NEB #M0491) as follows ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR product was indexed with Illumina sequencing primer-set by utilizing the Phusion HF Taq Polymerase (NEB), followed with gel purification ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR reactions were set up using primers specific to either CRISPRi or CRISPRa sequences using Phusion polymerase (NEB) according to the manufacturer’s instructions and using 3 different conditions to minimize amplification bias (HF buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Universal PCR primers and Index (X) Primer (NEB). PCR products were then purified (AMPure XP system ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was first linearly pre-amplified with 10 nM final concentration 5p-CCR5_UMI primer using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl of SR RT primer (NEB-kit) and 1.75 μl of nuclease-free water to each sample followed by incubation at 90°C for 30 s ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μM dNTPs and 2500 nM NEBNext Universal and Index Primer each (Primer Set 1, NEB). PCR products were purified by native PAGE and ethanol-precipitated ...
-
bioRxiv - Microbiology 2019Quote: ... The purified DNA was used as template to perform the 2nd step PCR using NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs), followed by Bioanalyzer analysis and gel purification ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR reaction volumes were set up to 12.5 μL containing Luna Universal qPCR Master Mix (New England Biolabs Inc.), 2 μl of a 1:10 dilution of cDNA reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB) and sequenced on an Illumina Novaseq 6000 (2×150 bp ...
-
bioRxiv - Bioengineering 2023Quote: ... Index sets in the NEBNext Dual Index Primers (New England BioLabs) were carefully chosen and added to the barcoded FXN region by performing PCR at 10 cycles of 98°C for 10s ...
-
bioRxiv - Bioengineering 2023Quote: ... NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, 7335S) were used for the final PCR amplification ...
-
bioRxiv - Microbiology 2022Quote: ... The standard curve was created from PCR product generated using the inovirus primer set (above) and a Phusion® High-Fidelity DNA Polymerase (NEB) using extracted DNA from each strain as a template ...
-
bioRxiv - Systems Biology 2022Quote: ... Unused RT primers were digested using Exonuclease I (NEB) and wells were pooled by half plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... Excess RT primers were digested using Exo I (NEB). RNA was hydrolyzed by NaOH (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA using primers oAS344 for cRNA and oAS345 for vRNA (Supplementary Note 21).
-
bioRxiv - Cell Biology 2021Quote: ... Universal PCR primers and Index (X) Primer (New England BioLabs). At last ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Genetics 2019Quote: ... Hi-C DNA was amplified using Index Primers set 1 (NEB, E7335S). The Hi-C libraries were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: ... with NEBNext Multiplex Oligos for Illumina primer sets (NEB #E7335 and #E7500). mRNA libraries were quality controlled via TapeStation then pooled and sequenced using single-end 75 bp reads on an Illumina MiSeq instrument in the UT Southwestern McDermott Center Next Generation Sequencing Core Facility.
-
bioRxiv - Microbiology 2021Quote: ... with NEBnext Multiplex Oligos for Illumina (Primer Set 1) (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Immunology 2021Quote: ... NEBNext Multiplex Oligos for Illumina Dual Index Primer Set 1 (NEB, E7600S) was used for library construction ...
-
bioRxiv - Immunology 2022Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB, E7335S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were dual-indexed (NEBNext Dual Index Primers Set 1, NEB E7600S), and sequenced on an Illumina NextSeq 2000 instrument with P3 300 cycle reagents ...
-
bioRxiv - Microbiology 2023Quote: ... with NEBnext Multiplex Oligos for Illumina (Primer Set 1) (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB, #E6440G), followed by 2×150 bp sequencing on the Illumina MiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB). All libraries were sequenced 150bp paired end using an Illumina Novaseq 6000 with 15 million reads on average per sample.
-
bioRxiv - Cell Biology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB E7335) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primer sets were used with Fusion high fidelity DNA polymerase (NEB M0530L) with the manufacturer-recommended protocol and standard molecular cloning techniques (Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... The NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, USA) was used for multiplexing ...
-
bioRxiv - Molecular Biology 2020Quote: Targeted sequencing for specific off-target or on-target sites was performed via a standard 2-step PCR using gene-specific primers with adaptors in the first round of PCR amplification and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (New England Biolabs) for the second round of PCR amplification ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from 1 μg of RNA using the ProtoScriptTM M-MuLV Taq RT-PCR kit and random primers (New England BioLabs). Quantitative PCR using SYBR select master mix (Applied Biosystems ...