Labshake search
Citations for New England Biolabs :
51 - 70 of 70 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2021Quote: The library of plasmids pSB/IR-CA-HybIntr-2×99intr-SV40intr-BleoR-T2A-mCherry was obtained by cloning of the library of DNA duplexes generated by renaturation of oligonucleotides 130-99intr-F and 131-99intr-R (with completion of complementary DNA T4 strands with DNA-polymerase and restriction by endonucleases BsaI (NEB, USA) and KpnI ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 400 nM of each of the flanking primers PS1057-NGS-F and PS1057-NGS-R (S2 File) and 0.1 units/µl of LongAmp Taq DNA polymerase (NEB Cat. # M0323L). In a second amplification step ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA fragments were used to generate a library with the NEBNext R© Small RNA Library kit (NEB ref E7330S, UK), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the genotype fhuA2 [lon] ompT gal sulA11 R(mcr-73::miniTn10--Tet)2 [dcm] R(zgb-210::Tn10--Tet) endA1 Δ(mcrC-mrr)114::IS10(New Engalad Bioloabs, NEB) was used in this study ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’UTR - GluA1flip(R) - 3’UTR and GluA3 flip(Q) (Y454A/R461G) was obtained using the Q5® Site-Directed Mutagenesis Kit (NEB). To obtain Halo-tag - GluA2flip(Q ...
-
bioRxiv - Bioengineering 2024Quote: ... and phosphorylated (1 μL 100 μM F oligo, 1 μL 100 μM R oligo, 1 μL T4 ligase buffer (NEB, B0202S), 1 μL T4 PNK (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MYPT1 and PKA-R and fragments thereof were amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs, Herts, UK) and subcloned into appropriate vectors for expression as Myc tag fusions in mammalian cells or for expression in E ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: A 1.9 kb upstream of the transcription start site ATG of the At1g77960 gene was PCR amplified with RGO-promo-F and RGO-Promo-R primer pairs using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Whitby, ON, Canada) with Arabidopsis genomic DNA as the template and was verified by DNA sequencing (Eurofins Genomics ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...