Labshake search
Citations for New England Biolabs :
1 - 50 of 70 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... a denaturing purification using 6M guanidium hydrochloride was done using Ni-NTA spin columns (NEB, S1427). Column elution was concentrated using an Amicon 30 kDa filter (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 70 mM Tris-Hydrochloride (Tris-HCl, pH 7.6 at 25°C) and 1 U/µl T4 PNK (New England BioLabs). Reaction mixtures were incubated at 37°C for 30 min ...
-
bioRxiv - Synthetic Biology 2020Quote: Purified RNA was reverse-transcribed with MuLV-R (NEB) and Random Primer Mix (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with primers AAVS1_CAG_fl_STOP_fl_F & R to introduce MluI (NEB, R3198S) and KpnI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... 601-R fragments were generated through Bgl I and Dra III (NEB) double digestion of pJW013 ...
-
bioRxiv - Molecular Biology 2021Quote: All mRNA generating plasmids were digested with PvuII-HF (NEB R[Δ4]151L) and ApaLI-HF (NEB R0507L ...
-
bioRxiv - Genomics 2020Quote: ... M.HhaI (a kind gift from Dr. R. J. Roberts, New England Biolabs, USA) and M.SPRI (a generous gift from Prof ...
-
bioRxiv - Genetics 2023Quote: ... The ICU11_sgRNA1_F/R oligonucleotides were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and hybridized in a thermal cycler (Bio-Rad Laboratories T100) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Annealed bubble templates and digested 601-R fragments were ligated using T4 DNA ligase (NEB) and ligated products were further purified through Model 491 Prep Cell to remove free bubbles and 601R fragments.
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of R-loop-containing plasmid was incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Pathology 2021Quote: ... Sequencing libraries were generated using NEBNext R UltraTM RNA Library Prep Kit (Illunina, NEB, United States) and the library quality was assessed on the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mutant env gene was amplified from pTZ57/R-env plasmid pools using Phusion DNA Polymerase (NEB) and primers from 5’ and 3’ ends ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Genetics 2023Quote: ... The T7 promoter and mtdTomato CDS were amplified from pmrPTRE-AAV using PTRE_floxed_F/R and Phusion High-Fidelity PCR Master Mix (NEB). NotI and SalI sites added by the primers were used to subclone this amplicon into pRM1506_TMM432 ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1600 v/10 ms /3 pulses for 200,000 cells in Buffer R (Neon Transfection kit) premixed with 50 pmol Cas9 protein (CAT#M0646T, New England Biolabs), 50 pmol single guide RNA (sgRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ompT lacZ::T7.1 gal sulA11 ∆(mcrC-mrr) 114::IS10 R(mcr-73::)miniTN10(TetS) endA1 [dcm]) (New England Biolabs) was used for protein expression and purification.
-
bioRxiv - Synthetic Biology 2022Quote: ... long overlapping primers tRNA-fMet-C1G_temp F and RNA-fMet-C1G-A_temp R (Extended Data Table 1) were PCR amplified using Q5 DNA polymerase (NEB). Products were gel purified and amplified using short primers tRNA-fMet-C1G_amp F and tRNA-fMet-C1G-A_amp R (Extended Data Table 1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified with primers ABEmax-F and ABEmax-R to enable digestion of the 2.6kb PCR product with AgeI (NEB) and PspOM1 (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... cloned into the pJR16 vector in two steps (Gift from R. Johnston, Johns Hopkins University) using HiFi DNA Assembly (New England Biolabs). pJR16 uses an EGFP reporter with a nuclear localization sequence (nls) ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: ... Modification of the coding sequence of the multibasic S1/S2 cleavage site PRRAR to PGSAS or to a single R was carried out by PCR mutagenesis using Q5 polymerase (New England Biolabs). Introduction of cysteine crosslinks and modification of residues 986 and 987 were carried out using Q5 polymerase PCR with primers containing desired substitutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 10μg of undigested total RNA samples and the above-mentioned RNase R-treated RNA were added with RNA loading dye (NEB) and denatured for 10min at 70°C ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and GST-Elm1-R (GATGCGGCCGCTCGAGCTATATTTGACCATTATCTGCAAAG) to amplify each Elm1 phospho-mutant and cloned into pGEX-4T1 using BamHI and XhoI (New England Biolabs). All plasmid constructs and mutagenesis were confirmed correct via sequencing at the DNA Sequencing Facility ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Cell Biology 2024Quote: ... StrepII-EPLINα WT plasmid was created by inserting the EPLINα PCR product (created with EPLINα Strep F/R primers) into pcDNA3 StrepII MCS vector cleaved with EcoRI/AgeI using NEBuilder HiFi DNA Assembly (NEB). The deletion mutants (ΔNHX ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was converted into Illumina-compatible libraries with the NEBNext(R) Ultra(TM) II DNA Library Prep Kit (NEB E7645L) following the protocol described by 41 and using NEBNext Dual Index Multiplex Oligos (NEB E7600S) ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Cell Biology 2024Quote: ... F and mCh oma-1(378) R (Table S2) and then cloned into pVIG57 (gift of Vincent Galy) using a HiFi reaction (New England Biolabs). The resulting plasmid pCFJ150_Pmex-5:CTPD::mCh::LGG-2 was injected for MosSCI (19 ...
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...