Labshake search
Citations for New England Biolabs :
51 - 100 of 1553 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 10-beta from New England Biolabs (NEB) was used for sensor assays ...
-
bioRxiv - Synthetic Biology 2024Quote: ... NEB 10-beta cells (New England Biolabs, Ipswitch, MA) were used for cloning and testing of all constructs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Microbiology 2021Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs C3020K) and plated at a target bottleneck of 50,000 variants per duplicate library ...
-
bioRxiv - Genomics 2022Quote: ... The product was transformed into 10-beta Electrocompetent E.coli (NEB), by electroporation with 2.0kV ...
-
bioRxiv - Microbiology 2022Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs C3020K) and plated at a target bottleneck of 100,000 variants per duplicate library ...
-
bioRxiv - Immunology 2022Quote: ... coli (NEB 10-beta electrocompetent cells, New England BioLabs #C3020K), and bottlenecked to ∼1 × 105 cfus (an average of >25 barcodes per single-mutant) ...
-
bioRxiv - Genomics 2023Quote: ... followed by transformation into 10-beta competent cells (NEB, C3020) using the Gemini X2 machine (BTX) ...
-
bioRxiv - Immunology 2024Quote: ... we electroporated 100 µl of NEB 10-beta (NEB, #C3020K) in a BioRad electroporator using the preset E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... commercial 10-beta competent cells (New England Biolabs, Ipswitch, MA) were transformed with plasmids carrying a canvas repeat sequence-targeting sgRNA cassette driven by strong constitutive promoter apFAB36 [21] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Developmental Biology 2020Quote: ... and transformed into NEB 10-beta Competent E.coli (NEB, Ipswich, MA). Colonies positive for the Lgals3-R200S allele by PCR were grown overnight at 37 °C with nutation at 200 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... coli K-12 DH10B (Neb 10-beta, NEB catalogue no. C3019H), E ...
-
bioRxiv - Microbiology 2020Quote: ... and the assembly reaction used to transform E.coli (NEB 10 beta). Colonies positive by PCR screening using primers that flank the cloning site were sequenced across the entire S coding region and a single positive isolate adopted for all further manipulations.
-
bioRxiv - Microbiology 2021Quote: Escherichia coli (NEB® 10-beta Electrocompetent E. coli or NEB® 5-alpha Competent E ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Genetics 2019Quote: ... Clones were transformed into electrocompetent 10-Beta cells (New England Biolabs # C3020) using a 96-well plate electroporator using fresh electroporation plates (BTX 45-0450-M) ...
-
bioRxiv - Genetics 2019Quote: ... coli strains NEB10®-beta (New England BioLabs Inc., Ipswich, MA, USA), and XL1-blue (Agilent Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... the library was transformed into elec-trocompetent NEB 10-beta cells (NEB) to yield ¿1000x transformants per gene ...
-
bioRxiv - Genetics 2019Quote: ... and transformed into high efficiency 10-beta competent E.coli (New England BioLabs) to generate pDestTol2pA2_ubi:f5-p2A-EGFP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... NEB 10-beta/Stable Outgrowth Medium (450 μL; B9035S, New England Biolabs) was added to each aliquot and the mixture was shaken vigorously (1250 rpm ...
-
bioRxiv - Genomics 2019Quote: ... The library was then transformed into 10-beta electrocompetent cells (NEB C3020), grown in 100 mL of LB+Amp ...
-
bioRxiv - Genomics 2020Quote: ... concentrated 4x and transformed in electrocompetent E.coli cells (10-beta Electrocompetent, NEB). Cells were recovered in SOC medium and plated on LB with Ampicillin ...
-
bioRxiv - Molecular Biology 2022Quote: ... Correct constructs were re-transformed into 10-beta chemically competent cells (NEB), plated on LB agar plates containing chloramphenicol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then transformed into NEB 10-beta competent cells (New England BioLabs). Plasmid DNA was extracted from ten positive clones using the GeneJET Plasmid Miniprep Kit (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Correct constructs were re-transformed into 10-beta chemically competent cells (NEB), from which clones were used to prepare glycerol stocks (25% glycerol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting product was transformed into 10-Beta Electrocompetent cells (NEB C3020K). We plated 1% of the library to estimate complexity and grew the rest of the sample and then midi prepped (Zymo D4200 ...
-
bioRxiv - Biochemistry 2021Quote: ... as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB). Inserts from single colonies were PCR amplified (using primers pGEM_T7_Fo ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat. #3020). DNA was extracted using a Qiagen Plasmid Midi Kit (Qiagen Cat ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The resulting plasmid lentiMPRA library was electroporated into 10-beta competent cells (NEB) using a Gemini X2 electroporation system (BTX ...
-
bioRxiv - Microbiology 2022Quote: pWR1566 was purified from laboratory E.coli strain NEB 10-beta (New England Biolabs) and used to transform V.cholerae strain WR2700 using electroporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... chemically competent DH5α cells or NEB 10-beta competent cells (NEB, Cat#C3019). Constructs were selected on LB plates (1% Tryptone ...
-
bioRxiv - Genetics 2023Quote: ... and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat. #3020). Plasmids were purified using a Qiagen Plasmid Midi Kit (Qiagen Cat ...
-
bioRxiv - Systems Biology 2023Quote: ... The transformation into NEB 10-beta electrocompetent E.coli (New England Biolabs, Ipswitch, MA) was performed slightly differently ...
-
bioRxiv - Systems Biology 2023Quote: ... Two transformations into NEB 10 beta electrocompetent cells (New England Biolabs, Ipswitch, MA) were performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... and resuspending cells in 950 uL 10-beta/Stable Outgrowth Medium (NEB, B9035S). Serial dilutions of 10 uL were immediately spread onto Ampicillin selection plates to assay transformed library complexity (>= 10,000x) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Wild type ϕ29 was purchased from NEB as positive control ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNAse type IV (New England Biolabs/ Bioconcept) in DMEM/F12 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Microbiology 2023Quote: ... The purified ligation reaction was transformed into NEB-10-Beta competent cells (NEB C3020K) and the lawns resulting from this transformation were pooled together and inoculated into LB broth supplemented with kanamycin ...
-
bioRxiv - Microbiology 2023Quote: ... All four libraries were independently electroporated into NEB 10-beta electrocompetent cells (NEB, C3020K) and plated on LB agar supplemented with 15 μg/ml gentamicin at 37°C overnight.