Labshake search
Citations for New England Biolabs :
451 - 500 of 1553 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... This was confirmed in N1 heterozygous AtrxR245C/+ females after digestion of the wild-type allele using FspI (NEB R0135S) and gel purification of the uncut mutant band ...
-
bioRxiv - Immunology 2023Quote: ... We pooled the second set of eBlocks at equal molar ratio and used Esp3I Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic regions of about 1 kb were amplified from wild-type genomic lysates using Q5 Hot Start high-fidelity polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Neuroscience 2019Quote: ... The R1320P mutation was created in a wild-type cDNA using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Wild-type and R1320P mutant dNf1 were then subcloned into the pUAST-attB vector with an in-frame C-terminal fusion with eGFP cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Most point mutants and wild-type variants were generated from this vector following the Q5 Site-Directed Mutagenesis Kit protocol (E0554, New England Biolabs) and primers 1-8 (Sup ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Cell Biology 2021Quote: To generate inducible vectors for MST2 wild type and del EDG we amplified the Flag2x _Strep2x fused to the MST2 constructs (wild type and del_EDG) with Q5 High-Fidelity Polymerase (New England BioLabs, # M0492) using specific primers (EcoRI_Flag_Fw and MST2_AgeI_Rv ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wild-type (wt) gRNA was in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR plasmid with mutant me31B genes was generated by mutating the me31B wild type gene in the wildtype HDR donor plasmid by using the Site-Directed Mutagenesis kit (New England Biolabs) according to the manufacturer’s recommended protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg of total RNAs from wild type LCL 25 and LCL MM were treated with DNAse I (M0303S-NEB), and reverse transcription was carried out with random hexamer primers (S0142-Thermo Scientific™ ...
-
bioRxiv - Biophysics 2022Quote: ... the assembled sequences were transferred to the target plasmids (WT, MUT) by using a different set of type IIS enzymes (BbvI, New England Biolabs #R0173 ...
-
bioRxiv - Microbiology 2022Quote: The full-length badR gene was amplified from the genome DNA of the wild-type Borrelia using High-Fidelity Taq Polymerase Fusion (NEB). The fragment was subsequently ligated into the pMAL-c2X (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The relative abundance of oligomannose-type glycans was measured by digestion with Endoglycosidase H (per sample in 20 µl volume) (Endo H; New England Biolabs). A 6 µl aliquot of labelled glycans was combined with 1 µg endoH to a final volume of 20 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Multilayer genetic circuit plasmids were constructed using PCR and Golden Gate assembly (GAA) using BsmBI Type IIS Enzyme (New England Biolabs), and sRNA plasmids using BsaI Type IIS Enzyme (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were combined into a transcription unit plasmid in a Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs). The destination vector (p15A origin of replication ...
-
bioRxiv - Microbiology 2023Quote: ... Variants of the Bil system were generated by amplification of the plasmid containing the wild-type Bil system12 using primers that contained the desired modification followed by treatment with KLD enzyme mix (NEB) according to the manufacturer’s instructions to obtain transformable plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Biochemistry 2023Quote: The K164A mutant was made by site directed mutagenesis using wild type LhCE as template with the Q5 Site-Directed Mutagenesis Kit from NEB using following primers:
-
bioRxiv - Synthetic Biology 2024Quote: All replicative plasmid backbones were constructed using the Golden Gate Assembly strategy with the type II restriction enzyme Esp3I (NEB) according to the manufacturer’s protocol (Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proximal regions were then amplified from the wild-type construct to generate fragments with appropriate overhangs for assembly by NEBuilder HiFi DNA Assembly (New England Biolabs) into pKLM79 (cut with MluI and SpeI ...
-
bioRxiv - Biochemistry 2023Quote: ... and linearized by the appropriate Type IIS enzyme (BspQI or BsmBI) and purified by Monarch RNA Cleanup kit (New England Biolabs) prior to IVT reactions.
-
bioRxiv - Developmental Biology 2023Quote: ... Isoseq library preparation was performed on 300 ng of RNA (RIN ≥ 9.3) of each cell type (isolated as described above) using NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification (NEB), Iso-Seq Express Oligo Kit (PacBio ...
-
bioRxiv - Plant Biology 2024Quote: ... Nucleotide changes leading to amino acid substitutions for Pic3 and Pic12 were first created in pENTR/D-TOPO (which contained wild-type Pic3 or Pic12) vectors by using the Q5 site-directed mutagenesis kit (New England Biolabs) with specific primers (Supplemental Table S4) ...
-
bioRxiv - Genomics 2024Quote: ... and the wild-type (USH2A:c.7595-2144A) minigene plasmids were generated by Q5® High-Fidelity DNA Polymerase (New Englands Biolabs) amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2024Quote: DNA fragments for wild-type and mutant GART were ordered from IDT (see below) and PCR amplified with Phusion DNA polymerase (New England Biolabs) with FWD_adapter and REV_adapter primers from IDT (see below) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...