Labshake search
Citations for New England Biolabs :
51 - 100 of 1702 citations for IL 10 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 10 μl reaction using 10 U T4 RNA ligase (New England Biolabs) in 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µl of 10×CutSmart Buffer and 10 µl of Hae III (NEB, #R0108L) were added to each tube ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μL RNAs were mixed thoroughly with 1 μL T4 PNK (10 U, NEB), 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified human gDNA was digested with the restriction enzyme HaeIII (NEB, Ipswich, Massachusetts) per the manufacturer’s instructions to yield an average of 347-bp DNA fragments22 ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 units BsaI (NEB #R3733), 10 units PNK (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units BsaI-HFv2 (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl MboI (NEB R0147S), 5 μl CviQI (NEB R0639S) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mm NTP mix (NEB), Ribolock (Thermo scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli cells (NEB 10-beta). The recombinant N-terminal His6-tagged TrxA protein encoded by slr0623 was expressed and purified as previously described previously for His-tagged proteins (Lapina et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 U BsaI-HFv2 (NEB) for assembly into levels 1 and 3 or 10 U BpiI (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 10 µg λ DNA (NEB) was added to a 50 µL reaction with 80 µM biotin-dCTP (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μl PNK enzymes (NEB) and 15 μl of 10mM ATP and incubated at 37°C for 10 mins on a Thermomixture (1400 rpm) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10-beta (NEB C3020) cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 U MseI (NEB, R0525S), 1x ddPCR supermix for probes and 50-300 ng of genomic DNA (gDNA) ...
-
bioRxiv - Biochemistry 2021Quote: ... E.coli (NEB® 10-beta) containing both a Cas effector and gRNA plasmid (Table S3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U T5 exonuclease (NEB) were added ...
-
bioRxiv - Cell Biology 2020Quote: ... with 10 mM VRC (NEB) per coverslip for 10 minutes at room temperature ...