Labshake search
Citations for New England Biolabs :
51 - 100 of 2119 citations for Human IgG1 Anti SARS CoV 2 Spike S1 Antibody CR3022 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... plates were immunostained using a monoclonal antibody against SARS-CoV2 nucleoprotein (Creative-Biolabs; NP1C7C7) at a dilution of 1:1000 followed by 1:5000 anti-mouse IgG monoclonal antibody and was developed using KPL TrueBlue peroxidase substrate for 10 minutes (Seracare ...
-
bioRxiv - Molecular Biology 2020Quote: The furin cleavage specificity was assayed by incubating 2.5 μg (7.6 μM) S1/S2-GB1-6xHis substrate with 2 U furin (New England Biolabs, p8077) in 30 μl reactions ...
-
bioRxiv - Physiology 2022Quote: ... sense and anti-sense oligo DNAs (IDT) (Table S1) were phosphorylation using T4 Polynucleotide Kinase (NEB) at 37 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... using the primers in (Table S1) by HiFi (NEB) cloning ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S R403T and RaTG13 S T403R/T403A mutant plasmids were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Immunology 2022Quote: ... Delta and BA.2 spike plasmids were linearized by restriction enzymes and transcribed to mRNA by in vitro T7 RNA polymerase (NEB, Cat # E2060S) as previously described10.
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... and spike-in lambda DNA (1.25 ng) (New England Biolabs) was sheared using the M220 ultrasound sonicator (Covaris ...
-
bioRxiv - Genomics 2023Quote: ... The DNA length and RNA absence were assessed by 2% agarose gel electrophoresis (50 V, 90 min) including the Quick-Load 1 kb DNA Ladder (New England Biolabs Inc., Ipswich, USA; Text S1). The extracted gDNA was not fragmented and larger than 10 kb (Fig ...
-
bioRxiv - Microbiology 2020Quote: The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
bioRxiv - Genomics 2022Quote: ... specific primers (Supplementary Table S1) were radiolabelled with T4 Polynucleotide kinase (NEB) and [?-32P]ATP (6,000 Ci/mmol) ...
-
bioRxiv - Developmental Biology 2021Quote: 4mC and 5mC spike-in controls were generated from pUC19 (NEB) PCR product synthesized with N4-methyl-dCTP (4mdCTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA linker L5 (Table S1) was ligated with T4 RNA ligase (NEB). RNA was purified by phenol/chloroform extraction ...
-
bioRxiv - Cell Biology 2022Quote: ... with primers detailed in Table S1 followed by DpnI (New England Biolabs, R0176) digestion before bacterial transformation and colony selection.
-
bioRxiv - Synthetic Biology 2024Quote: All protein expression constructs (Supplementary Table S1) were cloned using Gibson assembly (NEB, where double-stranded DNA fragments are either ordered from IDT as gBlocks or PCR amplified from existing constructs with at least 25-bp overlap in sequence ...
-
bioRxiv - Cell Biology 2021Quote: ... The Spike ORF was subcloned into pcDNA3.1(+) vector via Gibson Assembly (NEB). Subsequently ...
-
bioRxiv - Biochemistry 2022Quote: ... The thiolated spike-ins were made using T7 RNA polymerase (NEB M0251) on BamHI-digested templates ...
-
bioRxiv - Microbiology 2023Quote: ... Spike chimeras were generated through Gibson assembly of PCR generated fragments (NEB). Primers used for site directed mutagenesis and Gibson assembly are described in table 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: ... was separated into low-protein absorption tubes (PROKEEP; Watson Bio Lab, Tokyo, Japan) and reacted with 2 μg of rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs) or normal rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2021Quote: ... S1 and cloned into pAGM1311 vector by Gibson assembly (New England Biolabs, Ipswich, USA). The CRISPR plasmid and circular donor plasmid were co-transformed into SG200 protoplast and mutants were singled out on PD plate with 2 μg/ml carboxin for CRISPR plasmid first then transfer to PD plate without antibiotic to get rid of CRISPR plasmid ...
-
bioRxiv - Genomics 2021Quote: ... Tables S1 and S7) using NEBNext Ultra II Q5 Master Mix (New England Biolabs). Each reaction (100 µL total volume ...
-
bioRxiv - Microbiology 2022Quote: ... dsRNA was treated by enzymatic digestion with DNaseI and S1 nuclease (New England Biolabs) to remove DNA and ssRNA from the samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2020Quote: ... The DNA amplified fragments (Table S1) were digested with XhoI and NheI restriction enzymes (NEB). Expression of the resulting genes led to fusion proteins containing a His6 tag and a TEV Niα protease cleavage site ...
-
bioRxiv - Biochemistry 2021Quote: RNA substrates (listed in Table S1) were either 5’ labelled by T4 polynucleotide kinase (NEB) and 5’ 32P-γ −ATP ...
-
bioRxiv - Plant Biology 2021Quote: ... restriction enzyme analysis (Supplemental Table S1) was performed following the manufacturer’s recommendations (NEB, Bethesda, USA). The final PCR products were analyzed via 1.5% (m/v ...
-
bioRxiv - Genomics 2022Quote: ... we spike in 2.5 µL of 3M U/mL T7 DNA ligase (NEB M0318L) and continue incubating for 1 hour at 25C ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: The Bam35 genomic DNA was used to amplify the gene 2 flanked by KpnI and BamHI sites by PCR with B35SSB_FW_KpnI and B35sSB_RV_BamHI primers (Table S1) and Vent DNA Polymerase (New England Biolabs). The digested PCR product was cloned into a pET-52b(+ ...