Labshake search
Citations for New England Biolabs :
51 - 100 of 287 citations for Ferritin heavy chain FTH1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again with a GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... The polymerase chain reaction (PCR) was performed with “Taq DNA Polymerase with Standard Taq Buffer” (NEB) according to company’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were conducted using Q5 High-Fidelity 2x Master Mix (New England Biolabs) in the presence of 0.5 µM of forward and reverse primers in a volume of 25 µL ...
-
bioRxiv - Biochemistry 2020Quote: ... The polymerase chain reaction (PCR) included 1-unit Phusion High-Fidelity DNA Polymerase (New England Biolabs), 1x Phusion buffer ...
-
bioRxiv - Microbiology 2022Quote: ... The DST was removed by incubating the protein with 64 units of Enterokinase light chain (BioLabs) in 10 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo plasmid was linearized via Polymerase Chain Reaction (PCR) with the Q5 DNA polymerase (NEB) and a pair of primers for each Cac1 mutant that anneal to the sequences flanking the section to be modified (Supplementary Table 2) ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reactions were performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and all primers were synthesized by IDT (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... GFP and taCA were cloned by polymerase chain reaction (PCR) using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... Polymerase chain reactions (PCR) for cloning steps were performed with Phusion High Fidelity polymerase (New England Biolabs). KHNYN-2 (NM_001290256 ...
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were used in a polymerase chain reaction (PCR) with 2X Phusion Master Mix (New England Biolabs) and the appropriate parent plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in two stages of Polymerase Chain Reaction (PCR) using Q5 DNA polymerase (NEB). For the first PCR reaction ...
-
bioRxiv - Genomics 2023Quote: ... Real-time polymerase chain reaction (PCR) was performed using Luna® Universal qPCR Master Mix (NEB M3003L) and the Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad 1845097) ...
-
bioRxiv - Biochemistry 2024Quote: Point mutants were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs) or Herculase II (Agilent) ...
-
bioRxiv - Biochemistry 2024Quote: ... The strep tags were removed by incubating the proteins with 64 units of Enterokinase light chain (BioLabs) in 10 mM Tris ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reaction (PCR) amplification steps were performed using Phusion DNA polymerase (NEB, Whitby, Ontario, Canada). Primers used for PCR amplification were ordered from Integrated DNA Technologies (IDT ...
-
bioRxiv - Immunology 2019Quote: ... The generated cDNA was used as template for amplification of the emact full transcript using the primer pair Emact_Dw x Emact_Up by high fidelity polymerase chain reaction (Phusion, NEB). Resulting amplicons were sub-cloned into the pDrive cloning vector (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... and the polymerase chain reaction (PCR) was used to amplify DNA fragments with Phusion polymerase (New England Biolabs) of the genomic sequence using a forward primer that starts from 2199 bases upstream of the ATG start codon of zipt-2.3 and a reverse primer that contained the codon preceding the stop codon of zipt-2.3 and the coding sequence of the T7 epitope (MASMTGGQQMG) ...
-
bioRxiv - Immunology 2022Quote: The paired antibody VH/VL chains were cloned into Igγ and Igk expression vectors using T4 ligase (NEB). Antibodies produced from cell culture supernatants were purified immediately by affinity chromatography using recombinant Protein G-Agarose (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... polymerase chain reaction (Q5 High-Fidelity 2x Master Mix and OneTaq, Quick-Load 2X Master Mix, both NEB), PCR clean-up (Monarch PCR and DNA Cleanup Kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Genomics 2023Quote: ... were amplified by polymerase chain reaction (PCR) with the Phusion High-fidelity DNA Polymerase (New England Biolabs #M0530L), then both amplicons were assembled by Gibson assembly to produce the desired CRISPRoff-mScarletI plasmid.
-
bioRxiv - Biochemistry 2023Quote: ... Polymerase chain reactions (PCRs) were conducted with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA), PCR purifications with the Monarch® PCR & DNA cleanup kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The polymerase chain reaction (PCR) products were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs, MA, USA) with strict accordance to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Polymerase chain reaction (PCR) products and plasmids were purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs) and Sanger sequencing was performed by Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2019Quote: ... bovis C9.1 gDNA by polymerase chain reaction (PCR) with Phusion High-Fidelity DNA Polymerase (New England BioLabs; Beverley, MA) using primers EAM6 and EAM18 ...
-
bioRxiv - Synthetic Biology 2021Quote: Sub-parts (modules, Supplemental Table 1) were amplified via high-fidelity polymerase chain reaction (PCR) (New England Biolabs #M0491S) using dsDNA templates and ssDNA primers listed in Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction or gBlock synthesis (IDT) and assembled using HiFi assembly (New England Biolabs) according to the manufacturer’s instructions as shown in Table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2019Quote: ... Precipitated proteins were removed by centrifugation at 14000g for 30 min at 4°C and the remaining soluble protein was incubated with enterokinase light chain (NEB) for 16h at room-temperature as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA was isolated from the supernatant using the polymerase chain reaction (PCR) clean-up kit (New England Biolabs®) and quantified using a nanodrop ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biophysics 2019Quote: ... All the p53[R273] point mutations are done using overlap extension polymerase chain reaction by primers which are shown in Table S2 and then digested with Nde1(NEB) & BamH1(NEB ...