Labshake search
Citations for New England Biolabs :
1 - 50 of 287 citations for Ferritin heavy chain FTH1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: VH and VL sequences of candidate sequences were cloned into a pcDNA.3 based vector with dual CMV promotor harboring IgG1 heavy chain and light chain backbone using NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... and the V regions were inserted into cut backbone vectors (heavy chain: FJ475055; kappa chain: FJ75056) via Gibson reaction (New England Biolabs). Successful clones were prepared ...
-
bioRxiv - Immunology 2020Quote: Heavy and light chain vectors were verified by sequencing and transformed into DH5alpha cells (NEB). The transformed cells were grown and the plasmid was purified by midiprep (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... 18ng heavy or light chain fragment and 10ul of Gibson assembly master mix (New England Biolabs). 5-alpha competent E ...
-
bioRxiv - Immunology 2024Quote: ... Immunoglobulin heavy and light chain cDNA was amplified using the Q5 High-Fidelity 2X Master mix (NEB) and pooled forward primers that bind the leader sequences of the variable regions and the reverse primers that bind the first exon of the mu and kappa constant regions ...
-
bioRxiv - Immunology 2021Quote: ... PCR-product and linearized vector containing the constant part of IgG1 heavy or kappa/lambda light chain sequences respectively were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identity was >99.5% as verified by the cBASE module of BASE software ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into human IgG expression vectors ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into IgG expression vectors ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Tetravalent antibody constructs were generated by fusing these fragments with their respective IgG heavy chain in the pSCSTa mammalian expression vector using Gibson assembly (NEB). Fab-IgG constructs were arranged by fusing a heavy chain Fab domain to the N-terminus of the IgG via a S(G4S)3 linker ...
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain variable domain was then amplified from the cDNA using Q5 high-fidelity DNA polymerase (New England Biolabs) with the described primers (CALL001 ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids(von Boehmer et al., 2016) using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids(von Boehmer et al., 2016) using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids32 using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... the coding sequence of Fth1 was PCR-amplified (using ProtoScript II Reaction/Enzyme Mix by New England BioLabs, Ipswich, USA).
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Immunology 2020Quote: The second PCR product (V, D, J heavy genes) was cloned in frame by HiFi assembly (NEB, UK) into the KpnI/PstI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 μg of “heavy” or “light” THP-1 protein extract were dephosphorylated with 50 U of Antarctic phosphatase (NEB) in Antarctic phosphatase buffer (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were carried out with Q5 Hot Start High-Fidelity DNA polymerase (NEB). Colony PCRs were performed with Taq polymerase (NEB) ...
-
bioRxiv - Systems Biology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...