Labshake search
Citations for New England Biolabs :
51 - 100 of 4533 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2024Quote: ... A-tailed with Klenow 3’-5’ exo-(NEB), and truncated Illumina adapters were added with T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ pir-2 flank::PtrpC::nat::3’ pir-2 flank assembly was constructed using NEBuilder Assembly Kit (New England Biolabs). Each assembly fragment was either synthesized (T4 Oligo ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were sealed in a plastic bag and hybridized at 37 °C overnight with a 5′-(CCCTAA)5−3′ telomeric oligonucleotide probe 5′-end-labeled with T4 polynucleotide kinase (NEB M0201S) and [γ-32P]ATP (PerkinElmer BLU502A) ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL dNTP mix (NEB, 2 mM), 1 µL MgSO4 (100 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μl of 5 mM 3’ -desthiobiotin-guanosine triphosphate (DTB-GTP) (NEB product number N0761), 5 μl vaccinia capping enzyme (NEB product number M2080) ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was amplified in triplicate PCR reactions using oligonucleotides corresponding to the Illumina sequence adaptors (5’-AATGATACGGCGACCACCGAGATCTACAC-3’ and 5’-CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs, cat. M0531) for 11 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Biophysics 2024Quote: ... The PDZ and Protease domain of HtrA1 were amplified using primers 5’-ATCACCAAGAAGAAGTATATTG-3’ and 5’-GGATCCTTTTTCGAACTGC-3’ as well as 5’-TAGCTCGAGCACCACCAC-3’ and 5’-TTTGGCCTGTCGGTCATG-3’with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...