Labshake search
Citations for New England Biolabs :
401 - 450 of 4533 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Microbiology 2023Quote: ... the 5’-PPP RNA in the total RNA was specifically capped with 3’-Desthiobiotin-GTP (New England BioLabs, N0761) by the Vaccinia Capping System (New England BioLabs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... Two cycles of whole genome amplification were performed using 50 U of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), dNTP solution mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2020) and 5’Ncol1::mScarlet::3’Ncol119 plasmids using Gibson assembly according to the manufacturer recommendations (NEB, CAT#E2611). Sequences of Gibson primers used were:
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was dephosphorylated before Cas9 cleavage and dA-tailing (5 μg gDNA, 3 μL Quick CIP (NEB, M0525S), 3 μL 10X rCutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... mixing with 5 μL of stop buffer (50 mM EDTA and 2 mg/ml Proteinase K (NEB)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After CIP inactivation (2 min at 80°C) piRNAs were 5΄end radiolabeled by T4 PNK (NEB) with [γ-32P] ATP (10mCi/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... VCE or FCE::T7RNAP fusion and 5 U/μL vaccinia cap 2′-O-methyltransferase (New England Biolabs). Reactions were carried out at indicated temperatures for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... then combined with 5 μM dNTPs and 2 μL of 10× rCutSmart buffer (NEB, Ipswich, MA, USA) in a total reaction volume of 17 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragments were dephosphorylated by adding 5 μL antarctic phosphatase buffer and 2 μL enzyme (NEB cat#M0289S) and incubating for 1 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µL 10x T4 RNA ligase buffer and 5 µL T4 ssRNA ligase 1 (NEB, USA) were added and the reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/ml DNase I (NEB), 1x PhosStop phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
mRNA vaccines and hybrid immunity use different B cell germlines to neutralize Omicron BA.4 and BA.5bioRxiv - Immunology 2022Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...