Labshake search
Citations for New England Biolabs :
9901 - 9950 of 10000+ citations for Human Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; NEB; # E7760L). The libraries were sequenced on the NovaSeq platform as paired-end reads using the S1 v1.5 kit with 300 cycles (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... Illumina libraries were constructed from total RNA using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs, E7760) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 ng of RNA were retrotranscribed into cDNA using a LunaScript™ RT SuperMix cDNA Synthesis Kit (NEB, Cat. No. E3010L) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... C1-deleted pMYs-CIC::DUX4-IRES-EGFP was cloned from pMYs-CIC::DUX4-IRES-EGFP (a gift from Takuro Nakamura (52) and Michael Kyba (25)) using the Q5 Site-Directed Mutagenesis Kit (NEB E0554S) with the primers described in Supplemental Dataset S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Individually barcoded strand-specific libraries for mRNA sequencing were prepared from total RNA samples of high quality (approximately 150 ng per sample) using the NEBNext® RNA Ultra II Directional RNA Library Prep Kit (New England Biolabs) for 12 PCR cycles on the liquid handler Biomek i7 (Beckman Coulter GmbH ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... RNAseq libraries were then prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs #E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Genetics 2024Quote: ... and 0.5–50 ng of DNA/ChIP was used for library preparation using the NEBNext Ultra II DNA Library Kit for Illumina (NEB E7645) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of RNA was used as input for library preparation using the NEBNext Multiplex Small RNA Library Prep Kit for Illumina (NEB E7560S), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were collected after 24 h and RNA extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). RNA was extracted from adherent cells directly from the plate ...
-
bioRxiv - Cell Biology 2024Quote: ... The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs, E2621). This plasmid then underwent site-directed mutagenesis to produce pcDNA5-C1264R-Tg-FLAG ...
-
bioRxiv - Microbiology 2024Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA sequencing libraries were generated using the poly-A selection module in the NEBNext UltraII Directional RNA Library Prep Kit (NEB E7760) and sequenced on the Illumina HiSeq 2500 sequencer with single-end 50 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using an Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by fragmentation and the cDNA library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... the immunoprecipitated DNA was subjected to end repair and adaptor ligation reactions using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645), according to the manufacturer instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmids were transcribed in-vitro using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Cat No. E2050S) to produce RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared from 20 uL of ChIP DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S). Library molarity and quality were assessed by Qubit and Tapestation (DNA High sensitivity chip) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared by the EPFL Gene Expression Core Facility using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7760S), and sequenced on a NovaSeq6000 using 75-nucleotide read length paired-end sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... Mutagenesis was carried out in the PTPRH WT-HA plasmid using the Q5 Site-Direct Mutagenesis Kit (New England Biolabs #E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was fragmented into short fragments using fragmentation buffer and reverse transcribed into cDNA using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Purified double-stranded cDNA fragments were end-repaired ...
-
bioRxiv - Neuroscience 2024Quote: ... long amplification of the CHRFAM7A intron (exon A to exon 5) was carried out with the LongAmp® Taq DNA Polymerase Kit (ref. E5200S, New England Biolabs), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 ng of the PCR product was used in an in vitro transcription reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). The DNA template was digested through addition of DNase I after in vitro transcription ...
-
bioRxiv - Biochemistry 2024Quote: The pET15b-CtTrl1-LIG plasmid22 served as template for PCR-based site direct mutagenesis with one oligonucleotide for K148N and E328-stop (ΔCTD) variants or two oligonucleotides and Q5® Site-Directed Mutagenesis Kit (NEB) to introduce R334A ...
-
bioRxiv - Cell Biology 2024Quote: ... Site directed mutagenesis was performed according to the manufacturer’s instructions to introduce gRNA target-site mutations in wild-type Pcyt2 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554). Primers were designed using NEBaseChangerv1.
-
bioRxiv - Biochemistry 2024Quote: Active site mutations of PqqU were generated from the plasmid template pBAD24-pqqU using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Plasmids encoding TALE-free MTS–G1397-split DddAtox/DddA6/DddA11–UGI were generated with the Q5® Site-Directed Mutagenesis (SDM) Kit (NEB), using the corresponding herein developed backbone plasmids as templates for each final construct containing either the DddAtox ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reaction mixtures were treated with DNase I and incubated at 37 °C for 30 minutes before immediate purification (Monarch® RNA Cleanup Kit, NEB). A sample of each mRNA was reserved for quality analysis and transcripts were tailed with E ...
-
bioRxiv - Immunology 2024Quote: ... RNA aliquots were used for library preparation using NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, Ipswich, MA, USA). The PCR amplified cDNA construct (from 140–160 bp ...
-
bioRxiv - Microbiology 2024Quote: Library preparation and sequencing were conducted using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina with dual index primers and ∼300 ng of DNA (NEB Inc.) on an automation platform (Biomeki5 ...
-
bioRxiv - Microbiology 2024Quote: ... Gaussia luciferase and Cypridina luciferase expression levels were measured with a Biolux Gaussia luciferase assay kit (New England Biolabs, USA; #E3300) and Biolux Cypridina luciferase assay kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used to identify 5-methylcytosine and 5-hydroxymethylcytosine bases and sequencing libraries were constructed by NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645S), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Riboprobe for the full-length ACT1 gene was made using “HiScribe™ T7 Quick High Yield RNA Synthesis Kit” (NEB, USA) using Fluorescein labelling mix (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were converted to sequencing libraries using the NEBNext Small RNA Library Prep kit for Illumina (New England Biolabs, E7300) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: DICER RNA substrates have been obtained using PCR synthetized linear DNA bearing T7 promoter and HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040S) following manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Length of DNA Fragments were determined by agarose gel electrophoresis and then purified with Monarch DNA Gel Extraction Kit (NEB # T1020L). DNA concentration has been assessed by Nanodrop.
-
bioRxiv - Microbiology 2024Quote: ... was digested with XbaI and MluI restriction enzymes and barcoded linear HA libraries were inserted into the lentivirus backbone using NEB HiFi assembly kit (NEB E5520S). Assembled plasmid libraries were then electroporated into electrocompetent 10b cells (NEB C3020K ...
-
bioRxiv - Neuroscience 2024Quote: ... Stranded RNA sequencing libraries were prepared as described using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760L). Purified libraries were qualified on an Agilent Technologies 4150 TapeStation using a D1000 ScreenTape assay (5067-5582 and 5067-5583) ...
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.
-
bioRxiv - Immunology 2024Quote: ... Pathogenic ADA2 variants were created by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (#E0554; New England Biolabs) according to the manufacturer’s instructions ...