Labshake search
Citations for New England Biolabs :
901 - 950 of 1912 citations for Cytosolic arginine sensor for mTORC1 subunit 2 CASTOR2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 100-500 ng of genomic DNA was fragmented using 2 units of Nt.CviPII (NEB # R0626S) in 500 µl of 1X NEBuffer 2 at 37°C for 4 hrs to overnight ...
-
bioRxiv - Genomics 2024Quote: ... were prepared using the Q5 Hot Start High-Fidelity 2 × Master Mix (Cat# M0494L, NEB) as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... A molecular weight ladder was prepared using 2 µL of ssRNA ladder (New England Biolabs), 8 µL of RNase-free water (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Neuroscience 2021Quote: ... We used rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs), mouse monoclonal anti-CaM Kinase II α subunit antibody (05-532 ...
-
bioRxiv - Plant Biology 2021Quote: ... Beads with immobilized antibodies were collected through magnetic separation rack (NEB). Beads were washed with protein extraction buffer for 1 minute ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cell lysates were incubated with H4K5 Bu antibody (PTM Biolabs) or preimmune IgG per sample and 25 μl of magnetic protein G Dynabeads (catalog no ...
-
bioRxiv - Immunology 2020Quote: ... RNA was then immunoprecipitated with anti-m6A antibody (New England Biolabs) overnight at 4°C with head-over-tail rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used are as follows: pan-acetyllysine (PTM-Biolabs PTM-105), pan-butyryllysine (PTM-Biolabs PTM-301) ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... incubations were performed with primary rabbit antibody against N6-methyladenosine (NEB) or PAB2 (courtesy of Cecile Bousquet-Antonelli and Rémy Merret ...
-
bioRxiv - Biochemistry 2024Quote: ... Antibodies were the following: pan anti-Kbhb (PTM BioLabs, PTM-1201), pan anti-Kac (PTM BioLabs ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... 2 µL of cDNA mix was added to 50 µL Phusion High-Fidelity DNA Polymerase (NEB) reaction mix ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 RBD were conjugated to SNAP-Capture Pull-Down resin (New England BioLabs). For each conjugation ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pulse step was performed with 2 µM SNAP-cell TMR Star (New England Biolabs, S9105S) for 15 min followed by two washes with medium ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then inserted into pU6-2-gRNA plasmids using T4 DNA ligase (New England Biolabs # M0202S).
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Chromosomal and plasmidic DNA was removed by treatment with 2 units of DNase1 (New England Biolabs) for 2 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Genomics 2022Quote: ... a 2 μl mix of 6.4 U of Exo I (New England Biolabs, Ipswich, MA, USA), 32 U of Exo III (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... 2 μL of 10 mM i5 primer and 25 μL of 2x NEBNext Master Mix (NEB). The following PCR conditions were used ...
-
bioRxiv - Immunology 2022Quote: ... and IgGC-TBGH fragments into part 2 using NEBuilder HIFI DNA Assembly Mastermix (New England BioLabs). Following reaction 1 ...
-
bioRxiv - Plant Biology 2022Quote: Reverse transcription was performed using 2 µg of total RNA and M-MuLV Reverse Transcriptase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...