Labshake search
Citations for New England Biolabs :
901 - 950 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... centrifuged at 58,000 × g for 50 minutes at 4°C and the protein was batch purified using chitin beads (NEB). Protein-bound chitin beads were washed with lysis buffer and high salt buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The region of interest was amplified with specific primers (see Supplemental Table 4) and the Q5 DNA polymerase (NEB), and indexed by PCR using primers containing Illumina indexes (see Supplemental Table 4) ...
-
bioRxiv - Biophysics 2020Quote: ... T270 plasmid was digested by HpaI at 37°C for 4 hr in the CutSmart buffer (New England BioLabs) to place the (TTAGGG)270 at the middle region of the linearized substrate ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and protein was purified on amylose resin (NEB) including a high salt wash with buffer containing 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were cleared via centrifugation at 30,597xg and 4°C for 20 min and the supernatant was applied to amylose resin (NEB). The column was washed with 15 column volumes (CV ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the Schizosaccharomyces pombe rad9 intron was synthesized via fusion PCR (4) and inserted between BamHI and PstI (NEB). The N ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated in fresh medium containing 4 μM SNAP-Cell TMR-Star (New England Biolabs, Inc.) for 15 min at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... sequence in a reaction containing 40 ng/μl DNA (4 μg total) and 0.5 U/μl restriction enzyme (HindIII-HF; NEB, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 5’ arm of homology to exon 5 of the Il22 gene was cloned into NotI-EcoRI-digested pMACs 4-IRES.II (contains EMCV IRES and truncated hCD4) using T4 DNA Ligase (NEB). Second ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcodes (4-8 bp) and common adapters were ligated with 400 U T4 DNA ligase (New England Biolabs Inc.) at 22 C for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were eluted by mixing the beads with 21µl RNase H Elution Buffer and 4 µl RNase H (New England Biolabs) and incubated at 37 °C for 30 min while shaking ...
-
bioRxiv - Microbiology 2023Quote: ... Reactions were set up as per manufacturer’s instructions with the addition of 4 units of Murine RNase Inhibitor (NEB) and 5% DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... The ligation of vectors with gRNA inserts was performed overnight at 4°C using T4 DNA ligase (NEB, M0202). The ligation products were then transformed ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...