Labshake search
Citations for New England Biolabs :
9001 - 9050 of 9360 citations for Rat CD325 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were generated with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, Massachusetts) and subsequently sequenced in paired-end mode with 150- bp read length on a NextSeq500 to obtain ∼40 mio reads (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... and RNA sequencing was performed using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, E7760S) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was fragmented and TruSeq-Adapters ligated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina® (NEB) and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μl of which were transferred to a new tube and subjected to a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB #E7645), using half of the recommended reagents’ volumes ...
-
bioRxiv - Molecular Biology 2022Quote: ... AGTCCCCAGCACATAGAAGG hWISP1_negative_reverse: GGTTCTGAAGGTGACCGACT ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3-TNFR1 expression vector was generated by cloning with the primers indicated below to PCR amplify (using Q5 High-Fidelity PCR kit, New England Biolabs, Euroclone, Milan, Italy) the TNFR1 reference sequence from pBMNZ-neo-Flag-TNFR1 L380A (gift from Martin Kluger ...
-
bioRxiv - Cancer Biology 2022Quote: ... and bar-coded libraries were constructed using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich MA). Libraries were pooled and sequenced single-end (1×75 ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions to generate catalytic arginine point mutants for AIM18 and AIM46 were performed according to the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Table S2). SDM reactions were transformed into E ...
-
bioRxiv - Bioengineering 2022Quote: ... RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, Ipswich, MA) and then column purified ...
-
bioRxiv - Biochemistry 2022Quote: ... The two pairs of PCR products were ligated together by in vitro homologous recombination using a Gibson assembly cloning kit (NEB, Boston, MA, USA), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... full-length human MYO5 was cloned from the same cDNA library as above and inserted into the pHTN-HaloTag expression vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA synthesis was performed as a 20 μl reaction using the LunaScript® RT SuperMix Kit (NEB, following the manufacturer’s protocol) and cDNA was stored short-term at −20°C before transcriptional assessment.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Total RNA samples were subjected to library preparation using an NEB Next Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol (NEB #E7530) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared from 100 ng of DNA using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB E7805L) with NEBNext® Multiplex Oligos for Illumina® (E7600S) ...
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Microbiology 2022Quote: Meta3C sequencing libraries were generated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB catalogue number #E6177) following the manufacturer’s protocol with barcoding of the MluCI and HpaII libraries with the NEBNext® Multiplex Oligos for Illuminia® (NEB #E7335) ...
-
bioRxiv - Microbiology 2022Quote: ... USA) containing the desired sequences were first cloned into pKD3 or pKD4 (contain R6Kγ origin) using Gibson Assembly (NEB Gibson Assembly Cloning Kit) and maintained in PIR1 E ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Lucia and Cypridina luciferase activity was quantified by bioluminescence from aliquots of the cell supernatant (BioLux Cypridina Luciferase assay kit, New England Biolabs; Quanti-Luc, InvivoGen). Reference plasmid-normalized luciferase activity was from the average of three independent transfections ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... Transcription-unit (TU) plasmids were assembled with promoters and terminators from the MoClo kit using high-fidelity BsaI restriction enzyme (NEB, Ipswitch, MA, USA)51 ...
-
bioRxiv - Microbiology 2023Quote: ... and metagenomic libraries were prepared using 50 ng of DNA and the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Ipswich, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: ... PCR amplified fragments were assembled with BamHI and SbfI linearized pUA139 using the NEBuilder HiFi DNA Assembly kit (New England Biolabs Inc., MA, USA) to generate pTE24G ...
-
bioRxiv - Neuroscience 2022Quote: RNA library preparations for transcriptome analysis were performed using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (New England Biolabs, #E6420) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ligated to sequencing adapters and amplified using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® and NEBNext Multiplex Oligos for Illumina® (New England Biolabs). The amplified DNA (around 275 bp in size ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation was performed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs E7760S) and paired end sequencing was performed on the Nextseq 550 platform (Illumina) ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram of total RNA was used to prepare each sequencing library with the NEBNext Ultra II Directional RNA library prep kit (New England Biolabs Japan, Tokyo, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... using a NEBNext® single cell/low input cDNA synthesis and amplification kit (E6421L) which uses a template switching method to generate full length cDNAs (New England BioLabs, Ipswich, MA, USA). IsoSeq libraries were prepared from the cDNA according to standard protocols using the SMRTbell v3.0 library prep kit (Menlo Park ...
-
bioRxiv - Systems Biology 2024Quote: ... The poly(A) mRNA-enriched libraries were constructed using NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs, Ipswich, MA). Paired-end sequencing (2×150 bp ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequencing libraries were generated using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (E7770, New England BioLabs, Ltd., USA) by the Beijing Allwegene Technology Company Limited (Beijing ...
-
bioRxiv - Bioengineering 2024Quote: ... Synthetic RNA was generated through in vitro transcription of gene fragments using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) and quantified via qPCR standard curve.
-
bioRxiv - Genomics 2024Quote: ... multiplexed stranded cDNA sequencing libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, Ipswich, MA, USA) using poly(A ...
-
bioRxiv - Microbiology 2023Quote: ... A second PCR purification was performed prior to insertion of the Ultramers into the vector by DNA assembly with the NEBuilder HiFi DNA Assembly Kit (NEB, Cat. No. E2621). Next ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was cloned using either classical restriction and ligation ([55]; restriction enzymes, T4 DNA ligase and Quick Ligation kit from New England Biolabs, Ipswich, Massachusetts, USA) or isothermal assembly ([56] ...
-
bioRxiv - Plant Biology 2024Quote: 5 μl of ribosomal depleted RNA from each sample were used to prepare 64 individually barcoded RNA-seq libraries using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was extracted from 30-35 sets of MTs isolated from 5-7-day old female flies in five independent biological replicates using the Monarch Total RNA Miniprep kit (New England BioLabs, Whitby, ON, Canada). Total RNA was quantified using a UV spectrophotometer (Synergy 2 microplate reader ...
-
bioRxiv - Physiology 2024Quote: ... Double stranded RNA was synthesized by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Whitby, ON, Canada) following manufacturers recommendations ...
-
bioRxiv - Physiology 2024Quote: ... Samples were then thawed at room temperature and total RNA was isolated using the Monarch Total RNA Miniprep Kit following manufacturers protocol with an on-column DNase treatment to remove genomic DNA (New England Biolabs, Whitby, ON, Canada). Purified total RNA samples were subsequently aliquoted onto a Take3 micro-volume plate and quantified on a Synergy Multi-Mode Microplate Reader (BioTek ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNA-seq libraries were constructed using the NEBNext® Ultra™ RNA Library Prep Kit according to the manufacturer’s recommendation for Illumina® (NEB, USA). The library quality was assessed using the Agilent 2100 Bioanalyzer system ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were generated with the NEBnext® UltraTM DNA Library Prep kit for Illumina® (New England Biolabs, Inc., Ipswich, MA, USA). After quality assessment via Qubit (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were generated at the Novogene Bioinformatics Institute using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Strand-specific RNA-seq libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® sequencing (E7760S) according to the manufacturer’s protocol (New England Biolabs, MA USA). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were generated from 500 ng of total RNA using NEBNext Ultra II Directional Poly-A RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA; #E7760). cDNA library quality and quantity were assessed by TapeStation 2200 and Qubit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq and MNase-seq libraries were made using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, cat. no. E7645S) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: Library preparation for RNA sequencing was performed using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, USA, Catalog #: E7530L), strictly adhering to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Amplified genes were purified by agarose gel electrophoresis and extraction with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA, USA). Both the synthesized genes and PCR amplified genes were then inserted into a doubly digested BamHI/XhoI pET28b(+ ...
-
bioRxiv - Immunology 2024Quote: ... were prepared and sequenced at Azenta (South Plainfield, NJ) using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation ...