Labshake search
Citations for New England Biolabs :
9001 - 9050 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... for removal of contaminating genomic DNA before it was purified with Monarch® RNA cleanup kit (New England Biolabs, USA). The concentration of RNA and potential DNA contamination were quantified using Qubit™ RNA BR and Qubit™ dsDNA HS assay kits ...
-
bioRxiv - Molecular Biology 2022Quote: ... fluorophores were prepared by PCR amplification from the pTriEx-MLucV plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The proteins were expressed and purified in a similar way to MLucV ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA library was constructed following the manufacturer’s instructions of NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... David Sibley) into the sgRNA targeting the first exon of TgPRL gene by using Q5 Site-Directed Mutagenesis Kit (NEB). A DNA fragment containing the DHFR selection cassette flanked by short homology to the upstream and downstream of the guide RNA target site was amplified using pJET-DHFR (a gift from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription of 50 ng total RNA was performed using Protoscript II First Strand cDNA Synthesis Kit with oligo(dT)23 primers (NEB). cDNA was undiluted ...
-
bioRxiv - Developmental Biology 2022Quote: ... IGM generated sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760, New England Biolabs). A polyA enrichment step (E7490 ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were prepared for metatranscriptomic sequencing using the NEB-Next Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) with the addition of an rRNA depletion step (NEBNext rRNA Depletion Kit (Human/Mouse/Rat) ...
-
bioRxiv - Genomics 2022Quote: ... The remaining steps of library preparation were done using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers from New England BioLabs were employed ...
-
bioRxiv - Microbiology 2022Quote: ... 5 ng of total RNA was used for intact RNA library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760, New England BioLabs). To obtain sufficient RNA for the analysis of oral samples ...
-
bioRxiv - Microbiology 2022Quote: RNA library was assembled using NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490) and NEBNext Ultra II RNA Library Prep Kit for Illumina (E7770, New England Biolabs) as per manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... Then we performed the bead-on T7 transcription reaction by HiScribe™ T7 High Yield RNA Synthesis Kit (NEB E2040S). The amplified RNAs were processed to the PCR-cDNA sequencing kit (nanopore) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Sperm small RNA was converted to cDNA using the NEBNext Small RNA Library Prep Kit (New England Biolabs; Ipswich, MA) and sequenced as 75nt single-end reads on the Illumina NextSeq 550 platform (San Diego ...
-
bioRxiv - Genetics 2022Quote: ... PCR products were run on an Agarose gel and desired bands were isolated by gel extraction (QIAquick Gel Extraction Kit, New England Biolabs) and were eluted in ddH2O ...
-
bioRxiv - Biochemistry 2022Quote: ... Six histidine residues were added to the C-terminus of the sequence via the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resulting vector was transformed into OverExpress C41(DE3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared from the cDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Libraries were sequenced with the Illumina HiSeq 2500 or 4000 systems to produce 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). All plasmids were verified by sequencing (GeneWiz ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted RNA was then reverse transcribed to cDNA using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... digestion at 37°C for 30 minutes and then purified with the Monarch RNA Cleanup Kit (T2050, New England Biolabs) for long RNA (1020 nucleotides to 4187 nucleotides ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified fragment was cloned into BamHI site of pQF using an NEBuilder HiFi DNA assembly cloning kit (New England Biolabs) to generate pQFacvCDE ...
-
bioRxiv - Microbiology 2022Quote: ... Subgenomic replicons of GLT1-20M and GLT1cc were constructed with the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs) according to the manufacturer’s instructions using oligonucleotides as specified in Table S1.
-
bioRxiv - Immunology 2022Quote: ... Subsequently the libraries were prepared with the NEBNext® Ultra II DNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments of 500-1000bp upstream and downstream of each gene were inserted in pEX18Tc using the Gibson Assembly Cloning Kit (NEB) using standard protocols from the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... The final double strand DNA fragments pool was ligated with adapters and amplified with Illumina index primers by using NEBNext Ultra II NGS library prep kit (NEB). The prepared NGS library was sequenced as 150×150 bp pair-end sequencing in the Miseq or Hiseq 2500.
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Biochemistry 2022Quote: ... sequencing libraries were prepared with a NEBNext Ultra II Directional RNA Library Prep Kit (7765L, New England Biolabs, Ipswich, MA), and samples were sequenced on an Illumina NextSeq 500 platform in 76bp single-end reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... An equal amount of DNA from each sample was used for library preparation with the NEBNext DNA Ultra2 Library Preparation Kit (New England Biolabs). The library preparation was performed on an automated liquid handling system (Hamilton Robotics ...
-
bioRxiv - Biophysics 2022Quote: ... This construction was used as a template to introduce the mutation W330A using the Q5-Site Direct Mutagenesis Kit (NEB) with the oligonucleotides W330A-fw 5′-GAGCGGTACCGCCCTGACCTATACCG- and W330A-rv 5′-GGGGTAACTTCCATGCCA- ...
-
bioRxiv - Cell Biology 2022Quote: ... The assembled template was purified and subjected to in vitro transcription by T7 RNA polymerase using the Hiscribe T7 High Yield RNA Synthesis Kit (New England Biolabs). The reaction product was treated with DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were prepared using NEBNext Poly(A) mRNA magnetic isolation module and NEB Ultra Directional RNA Library kit for Illumina (New England Biolabs). Library quality ...
-
bioRxiv - Cell Biology 2022Quote: ... Poly-A(+) RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Two µg of RNA per sample were processed in two separate reactions (separate technical replicas ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries were prepared from mRNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) as by manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated mRNA was used to generate dual-indexed cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Eight cycles of PCR amplification were applied to all the libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... All the point mutations in the recombinant LC3B and GABARAP were generated by Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pGEX-6P1-GST-ATG3 was a gift from Dr ...
-
bioRxiv - Biochemistry 2022Quote: ... and cloned in the EcoRV and BamHI restriction site of the pBBR1MCS-2 (55) using the NEBuilder Assembly kit (New England BioLabs). pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were prepared from 200ng of input DNA with control DNA (CpG methylated pUC19 and CpG unmethylated lambda DNA) using NEBNext Enzymatic Methylation-seq kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... A total amount of 1 μg of RNA per sample was used to prepare cDNA libraries generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: Fragmentasion and adaptor ligation were performed using 10-20ng of second-PCR product as a template with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (E7805S, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... was generated by the assembly of 5 DNA fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). These DNA fragments ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng to 1 μg of input RNA was used as a template for reverse transcription using Protoscript II First Strand cDNA Synthesis Kit (NEB) and random hexamers ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was used as an input material for library preparation using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). The libraries were multiplexed and paired-end sequenced (2 × 75 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... Mutations in the sgRNA target site of the plasmid were introduced and neomycin was removed using Q5 Site-Directed Mutagenesis Kit (#E0554S, New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... 2389–4785 nt and 4786–4914 nt) were assembled into the pASW vector using NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... libraries were prepared in an additional 15 amplification cycles using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on the HiSeq2000 platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: Genomic libraries were created using the NEBNext® Ultra DNA library Prep Kit for Illumina sequencing (New England Biolabs, US) and genomes were sequenced on an Illumina MiSeq v2 500 (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were prepared according to NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, U.S.A.) followed by single end sequencing on a HiSeq3000 to produce 2-3 Gb data per sample ...
-
bioRxiv - Microbiology 2020Quote: ... RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs; Ipswich, MA, USA) and index codes were added to attribute sequences to each sample ...