Labshake search
Citations for New England Biolabs :
851 - 900 of 3967 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 2 µl of T4 DNA ligase (NEB), and 9 µl nuclease-free water were mixed and incubated at 22°C for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl of T4 DNA ligase (NEB), and 9 µl nuclease-free water were mixed and incubated at 22°C for 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 mM VRC (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 2 (New England Biolabs #B6002) at 37°C for 30 minutes followed by column purification ...
-
bioRxiv - Genomics 2023Quote: ... and 2 mM VRC (New England Biolabs) for 7 min on ice and stored in 70% ethanol ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl T4 PNK (NEB, #M0201L) to the dephosphorylated nuclei sample and incubate at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... + 2 mM vanadyl-ribonucleoside complex (NEB S1402) + 0.02% [w/v] BSA ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of Antarctic Phosphatase Enzyme (NEB), and 2 μl of water ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Zoology 2019Quote: ... The following PCR conditions were used to generate both fragments appropriate for sequencing: 5□μL of 5× NEB Q5 Reaction Buffer (New England Biolabs Ltd, USA) 0.5□μl ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Genomics 2019Quote: ... and 5 U exo-Klenow Fragment (New England Biolabs) for 1 h at 37 C followed by incubation with 80 U of TaqDNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Un-reacted linkers were digested by 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by incubation with Antarctic Phosphatase (NEB, 5 U) for an additional 2 hours at 37°C ...
-
bioRxiv - Biophysics 2019Quote: 5 µg of commercially prepared λDNA (New England Biolabs) was incubated with 0.025 U of Nt.BbvC1 in a final volume of 100 µl of 1 X CutSmart buffer (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... and retransformed into chemically competent NEB 5-alpha (NEB) to improve yields ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... 5 mM CaCl2) with MNase (#M0247S, New England Biolabs). The obtained digest (mononucleosomes ...
-
bioRxiv - Microbiology 2020Quote: ... at the 5’ end and NotI (New England Biolabs) at the 3’ end ...