Labshake search
Citations for New England Biolabs :
751 - 800 of 3967 citations for 5 Pyrimidinecarbonitrile 4 6 diamino 2 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... the 5-µl of Bst 2.0 (NEB, M0537S) enzyme mixture (1× isothermal buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Genomics 2024Quote: ... followed by 5′ cap repair with RppH (NEB) and 5′ hydroxyl repair with PNK (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: Purified GST-Bbs5 protein (400 μg) was incubated with 6 μl of PKC (New England Biolabs) and 10 μl of ATP (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Two-hundred nanograms of total RNAs were reverse-transcribed using Random primer 6 (New England Biolabs) and Superscript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... we introduced a 6-bp mutation using the Q5 site-directed mutagenesis kit (New England Biolabs). The pUAST-attB constructs were inserted into either attP40 or attP86Fb (for Piezo constructs ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Microbiology 2020Quote: ... and performed 6–9 cycles of PCR with the NEBNext Ultra II Q5 Master Mix (NEB) using Illumina P7 and the Seq-Well P5-TSO hybrid primer (Gierahn et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... Polylinker libraries were amplified using primers BC_CRX_Nested_F and BC_CRX_R (Supplementary file 6) for 30 cycles (NEB Q5) at an annealing temperature of 67C and then purified with the Monarch PCR kit ...
-
bioRxiv - Systems Biology 2019Quote: ... Biotinylation was performed in a 90 µl reaction with 6 U of T4 ssRNA Ligase (NEB), 4 µl Biotinylated Cytidine (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted dsRNA was mixed with Gel Loading Dye Purple (6×) (New England Biolabs, cat. #B7024S) and separated by 10% polyacrylamide gel (25 mA at 4°C for 18 hours) ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Genomics 2024Quote: ... the cfDNA can be de-phosphorylated by adding 6 μl of Antarctic Phosphatase buffer 10x (NEB), 2 μl of Antarctic Phosphatase Enzyme (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Genomics 2019Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...