Labshake search
Citations for New England Biolabs :
851 - 900 of 2080 citations for 2 6 Amino 9H purin 9 yl ethanol d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 25 µL NEBNext HiFi 2× PCR Master Mix (New England BioLabs) was added to the DNA mixture ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl of Gel loading dye without SDS (NEB, Ipswich, MA) were added to each reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Genomics 2024Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PNGase F (New England Biolabs catalog number P0704S), were combined with H2O to achieve a total volume of 10 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of Endo H (New England Biolabs catalog number P0702L), were combined with H2O to reach a total volume of 10 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μL Phusion® HS Flex polymerase (2 U/μL - NEB), in a final volume of 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... and was loaded onto 2 mL of chitin resin (NEB; #S6651S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was digested by adding 2 µL of PK (NEB) to the mixture and incubating at 45°C for 45 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL of 10X RNase H Buffer (New England Biolabs, M0297S), and 1 µL of RNase H (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... 200 mM NaCl and 2 µl of proteinase K (NEB # P8107S) and incubated overnight at 65°C to lyse nuclei bound to the beads and DNA was extracted using phenol-chloroform and precipitated using glycogen ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x reaction buffer (New England Biolabs, Ipswich, MA), 2 µl 0.1M DTT ...
-
bioRxiv - Biochemistry 2024Quote: gDNA was digested for 2 h with BamHI and XmnI (NEB). Multiplex 24 μL ddPCR reactions were prepared by mixing 12 μL of ddPCR supermix (no dUTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primers Set 1 and 2 (NEB, cat. no. E7335 and E7500). We proceeded by pulling the samples together ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Genomics 2023Quote: ... and chromatin was digested during 10 min at 37 °C with 6 Kunitz units of MNase (New England Biolabs, 200 Kunitz units/µl) per 1 million cells ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genetics 2024Quote: ... followed by a 10-fold dilution of the universal adaptor and 6 cycles of PCR with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, Cat. No. E7805S), and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
bioRxiv - Genomics 2022Quote: ... followed by reverse-crosslinking with 2 ug/uL proteinase K (NEB, P8102), 1% SDS ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... beads were resuspended in 50 μL of 1X NEBuffer 2 (NEB, B7002S) containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... We loaded genomic digests and 100ng of 2-log ladder (NEB N3200) onto a 1% agarose gel and subjected it to electrophoresis in 1XTTE overnight at 49V ...
-
bioRxiv - Immunology 2022Quote: ... a quantitative PCR reaction (10 µl 2 x PCR master mix (NEB), 1 x SYBR green (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37°C ...