Labshake search
Citations for New England Biolabs :
8801 - 8850 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: RNA from sorted Kmt2d-knockout and littermate control thymic cells was isolated by centrifugation to pellet and resuspended in 300 μL of Protection Buffer (Monarch RNA Isolation Kit, #T2010S; New England Biolabs Inc. (NEB), Ipswich ...
-
bioRxiv - Immunology 2022Quote: ... as described by Corman et al84 were used alongside the Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswitch, MA) and CFX384 Touch Real-Time System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation was performed using the NEB ultra DNA library preparation kit for Illmina (E7370) and Indexing primers (E7335S and E7500S) (New England Biolabs Inc, UK), following protocols described previously (Colles ...
-
bioRxiv - Neuroscience 2022Quote: ... the 181-bp and 376-bp amplicon products (Figure 1-figure supplement 1A) were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, Ipswich, MA) and sent for Sanger DNA sequencing at the OHSU Vollum Sequence Core (Portland ...
-
bioRxiv - Immunology 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: RNA was in vitro transcribed from 1 μg of agarose gel-purified band corresponding to the intended size using HiScribe™ T7 high yield RNA synthesis kit (cat#E2040S, New England Biolabs Inc) followed by adding a 5’ cap using the Vaccina Capping System (cat#M2080S ...
-
bioRxiv - Microbiology 2022Quote: Libraries for metagenome sequencing were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs), following the manufacturer’s recommendations with the addition of index codes ...
-
bioRxiv - Microbiology 2022Quote: ... RNA sequencing libraries were prepared using NEBNext Ultra II RNA Library Preparation Kit for Illumina by following the manufacturer’s recommendations (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2022Quote: ... The RNA sequencing library was prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2022Quote: ... The library for RNA-seq was prepared by using NEBNext Ultra II Directional RNA Library Prep kit (New England BioLabs, Ipswich, MA) and the sequencing was run on an Illumina HighSeq2000 with paired end reads ...
-
bioRxiv - Systems Biology 2022Quote: ... The sample preparation was performed according to the protocol “NEBNext Single Cell/Low Input RNA Library Prep kit for Illumina”(NEB #E6420S/L). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7645, New England BioLabs) with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared using a polyA selection method using the NEBNext Ultra II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA) and quantified using Qubit 4.0 Fluorometer (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... at -80 °C prior to RNA extraction and library preparation (performed by Novogene Company Limited with NEB Next® Ultra™ RNA Library Prep Kit (NEB)) prior to RNA sequencing (paired-end 150 bp ...
-
bioRxiv - Microbiology 2023Quote: ... Strand-specific RNA sequencing library was prepared by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... mRNA Magnetic Isolation Module and NEB Next Ultra II Directional RNA Library Prep Kit for Illumina with NEB Next Multiplex Oligos for Illumina (New England Biolabs Inc., USA), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... Library preparation was performed with Poly A selection and HiSeq xSequencing using NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Sequencing libraries were clustered onto 1 lane of a flow cell ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... the NPTII gene cassette (including promoter and terminator) was cloned into pAGM1311 and modified using HiFi DNA Assembly Cloning Kit (NEB, Ipswitch, MA) to replace the complete coding sequence of NPTII with the coding sequence of the hygromycin resistance gene from pMDC735 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, USA). DNA libraries for museum or archeological samples were built using a Blunt-End Single-Tube (BEST ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 2 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: Insertion of point mutations in mPiezo2 and the chimeric channel mP1/mP2 were carried out using the Q5® Site-Directed Mutagenesis Kit (NEB, Inc) according to the manufacture’s indications ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 150 ng RNA was used to prepare libraries using the NEBNext Ultra II Directional mRNAseq kit with poly(A)+ purification module (NEB E7760, E7490) as described with modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the entire ChIP DNA and 300 ng input DNA were used to construct libraries using NEBNext Ultra™ II DNA Library Prep kit for Illumina (NEB, E7645) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from 100 µL of whole blood using the blood protocol from the Monarch® Genomic DNA Purification Kit (New England Biolabs, Australia). In addition ...
-
bioRxiv - Neuroscience 2022Quote: ... Transcriptomic profile of individual BAT samples was performed using commercial RNA-sequencing kits (NEBNext mRNA Library Prep Master Mix and NEBNext Multiplex Oligos for Illumina, New England Biolabs, Ipswich, MA) and adapted according to previous descriptions [22] ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were then run on a 3% agarose gel and the product was extracted using NEB Monarch DNA Gel Extraction Kit (NEB, Cat# T1020L). Next ...
-
bioRxiv - Physiology 2022Quote: ... and RNAseq libraries constructed using an NEBnext Ultra RNA library prep kit with a poly A purification module (New England Biolabs, Ipswich, MA). Libraries were indexed using multiplex adapters made by IDT (Coralville ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing library for total RNA-sequencing was prepared using NEB Next Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat# E7530). Paired-end ...
-
bioRxiv - Microbiology 2024Quote: Complimentary DNA (cDNA) was prepared from 250 ng of total RNA using the First Strand cDNA Synthesis Kit (New England BioLabs Inc., USA), according to the manufacturer’s protocol ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... RNA sequencing libraries were prepared using the NEB-Next Ultra RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, Ipswich, MA, USA). The samples were sequenced on the Illumina 4000 instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... Enriched DNA was subjected to library construction using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (catalog no. E7645L, NEB), with the adapter ligation step performed at 50°C instead of 65°C ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA sequencing library preparation used the NEBNext Ultra RNA Library Prep Kit for Illumina followed by manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1pmol of each fragment were then assembled for 1h at 50°C using NEBuilder HiFi DNA Assembly master mix from the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, ref E5520S). Reaction products were amplified in provided bacteria and purified using QIAprep Spin Miniprep Kit.
-
bioRxiv - Immunology 2023Quote: ... The RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA and library preparation were performed using NEBNext® Ultra™ II Directional RNA Library Prep kit for Illumina (New England Biolabs). Library concentration was determined using NEBNext® Library Quant Kit for Illumina (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two hundred nanograms of RNA was used to generate sequencing libraries using the NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was prepared with 1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalog #E6560L) as instructed by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Systems Biology 2024Quote: ... 500 ng of total RNA was subjected to ribosomal-RNA depletion using the NEBNext rRNA Depletion kit (E7850L; New England Biolabs, Ipswich, MA), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared using a polyA selection method using the NEBNext Ultra II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA) and quantified using Qubit 4.0 Fluorometer (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... the sequencing libraries were generated using a NEBnext® Ultra™ II DNA library prep kit and NEBNext Multiplex Oligos (NEB #E7335) for Illumina (New England Biolabs) ...