Labshake search
Citations for New England Biolabs :
801 - 850 of 1635 citations for Recombinant Human ROR1 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complexes of SpCas9 protein (NEB; Ipswitch, MA), ssODN template and gRNA were prepared with final concentration 200 μg/μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Broad Range Protein Marker (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (New England BioLabs inc.). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... and PMP with Lambda Protein Phosphatase (P0753S, NEB) with Phosphatase inhibitor cocktail (4X ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL of λ protein phosphatase (NEB P0753S) was added and incubated at 37°C for 30 minutes and then placed on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were purified by Amylose resin (NEB) and eluted with 10 mM maltose ...
-
bioRxiv - Biophysics 2023Quote: ... and phosphorylated with protein kinase A (PKA) (NEB) for 1 hour at 20 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 30nM sgRNA and 30 nM Cas9 protein (NEB) for 1h at room temperature and analyzing cleavage products on a 2% agarose gel ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (PURExpress, New England Biolabs). Reactions were performed according to manufacturer’s instruction and as previously described in 82 with a few modifications ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP and Halo fusion proteins were labeled with JF549 or JF646 dyes (HHMI Janelia Research Campus) (Grimm et al., 2015) or SNAP-Cell Oregon Green® (NEB, S9104S).
-
bioRxiv - Cell Biology 2022Quote: ... The kinesin and GBP constructs were exchanged into 1x PBS with 1 mM DTT and labeled with DNA and SNAP-Surface Alexa Fluor 647 (NEB, Ipswich, MA) dye directly after elution ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcribed RNAs were treated with Antarctic phosphatase (Fermentas, Waltham, MA) to remove the 5’ terminal phosphate and then labeled by T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA) in the presence of γ-32P-labeled ATP (PerkinElmer ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... long overlapping primers tRNA-fMet-C1G_temp F and RNA-fMet-C1G-A_temp R (Extended Data Table 1) were PCR amplified using Q5 DNA polymerase (NEB). Products were gel purified and amplified using short primers tRNA-fMet-C1G_amp F and tRNA-fMet-C1G-A_amp R (Extended Data Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ompT lacZ::T7.1 gal sulA11 ∆(mcrC-mrr) 114::IS10 R(mcr-73::)miniTN10(TetS) endA1 [dcm]) (New England Biolabs) was used for protein expression and purification.
-
bioRxiv - Microbiology 2020Quote: ... Cloning and purification of full length IE86 protein: Full length IE86 protein was codon optimized and cloned in pMALcx5 vector (New England Biolabs Inc.). Cells were transformed in BL-21 cells and IE86-FL-pMALcx5 transformed cells were grown in 1L luria broth (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Phosphorylation of purified LPR1 protein was tested according to (Maldonado-Bonilla et al., 2014) using λ-protein phosphatase (New England Biolabs). In brief ...
-
bioRxiv - Genetics 2022Quote: ... along with 6uL of EZ-Run Pre-Stained Rec Protein Ladder (Fisher BP3603-500) and 3uL of Blue Prestained Protein Standard (NEB P7718S). Gels were electrophoresed in XT Tricine Running Buffer (Bio-Rad 1610790 ...
-
bioRxiv - Synthetic Biology 2023Quote: The cell-free protein synthesis (CFPS) reactions were carried out using the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs Inc) in 384-well plates (Thermofisher NUNC ...
-
bioRxiv - Microbiology 2023Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Cell Biology 2023Quote: ... a PCR fragment containing the complete Nv-osk coding sequence was synthesized for protein expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) using manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... To remove any remaining phosphorylation the GFP-Trap bound proteins were treated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Genomics 2020Quote: ... the circularized DNA was initially treated with human alkyl adenine DNA glycosylase (hAAG, NEB) to cleave the N-glycosidic bond of etheno-dA bases ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were expressed in BL21 DE3 (New England Biolabs) at 37 °C and 180 rpm after Isipropyl-thiogalactoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... lysates were additionally dephosphorylated using Lambda protein phosphatase (NEB) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Then 1.5 ul of 50 μM LbaCas12a protein (NEB) or 1 ul of 63 μM AsCas12a Ultra protein (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were then further purified over amylose resin (NEB) and eluted with elution buffer (20 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... The donor DNA (0.6μM) with Cas9 protein (NEB #M0646T), crRNA and tracrRNA were injected in a 1:1:1:1 molar ratio into mouse zygotes by the UCSD Transgenic and Knockout Mouse Core (See Supplementary Table 4 for crRNA sequence) ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein lysates were generated using cell lysis buffer (NEB) and brief sonication on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... We digested the proteins with Proteinase K (NEB #P8107S) for 5 min at 50 °C ...
-
bioRxiv - Pathology 2021Quote: ... and 0.4 μg of T4 gene protein (NEB, M0300S)] ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2020Quote: ... against a Color Protein Standard broad range ladder (NEB) in NuPAGE MES SDS buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... A pre-assembled complex of purified Cas9 protein (NEB) and gRNA was injected and the efficiency of Crispr/Cas9-induced mutagenesis in the F0 generation monitored at 24 hpf using a T7 endonuclease assay (Jao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-protein complexes were dephosphorylated with T4 PNK (NEB) for 45 minutes in an Eppendorf Thermomixer at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μM of purified proteins mixed with PEG8000 (NEB) at 10% (w/v ...
-
bioRxiv - Biophysics 2019Quote: ... fusion proteins were directly biotinylated with BG-Biotin (NEB), buffer exchanged with a Zeba Desalting Column (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... MBP-MYB6 protein was purified on amylose resin (NEB) and HIS-PUB26 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...