Labshake search
Citations for New England Biolabs :
801 - 850 of 4925 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate Unlab. Dehp Metabolite V ;100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB) or 10 units of HpaII (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB), to assess the methylation status of two CpG sites in the promoter region ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and Cap 2’-O-Methyltransferase (NEB), followed by another purification by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL of USER enzyme (NEB) was added directly to each purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 U DNAse I (NEB). Then sonicated on ice for 10 sec and boiled 15’ at 99°C after adding 25 μL of SDS-PAGE 5x loading buffer and resolved by SDS-PAGE ...
-
bioRxiv - Genomics 2019Quote: ... 2 µl of USER enzyme (NEB) was added to the purified assembly reactions and incubated at 37 °C for 15 minutes followed by 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µl Endo H (NEB P0702S) and 3 µl of G3 reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Zoology 2022Quote: ... mRNA cap 2’-O-methyltransferase (NEB) and E ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Genomics 2023Quote: ... 2 (TOYOBO) and BsaI-HF (NEB) and incubated at 37℃ for 5 min and 16℃ for 5 min for three cycles ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x CustSmart buffer (NEB), 1 µl EcoRI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1 x GlycoBuffer-2 (Biolabs). After incubation for 60 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl Q5 DNA Polymerase (NEB). Amplification was done with an initial denaturation at 95 °C for 30 sec followed by 40 cycles at 95 °C for 10 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl T4-PNK buffer (NEB), 2 µl T4-PNK (10 U/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μg of the purified DNA was digested with 8 units of Endo V (New England Biolabs) in a 200 μL reaction at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme (NEB)) and incubated at 37°C for 3 hours with constant shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were labelled with 100 nM Halo-TMR ligand and 100 nM SNAP-Cell 647-SiR ligand (New England Biolabs) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DCR1 ORF along with its upstream and downstream sequence was amplified (primers: DCR1-Intergenic-For 5′-CCCCCTCGAGTTTGTAAAGAAATTGATGCTTCG; DCR1-Intergenic-Rev 5′-TGCAGGATCCGAATCTGGTATGGGATCATATTGG) and inserted between the XhoI and BamHI (NEB) restriction sites of pRS402.
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The AGO1 ORF along with its upstream and downstream sequence was amplified (primers: AGO1-Intergenic-For 5′-GCTGGAGCTCTGAACGTGTGGAAGACCAAA; AGO1-Intergenic-Rev 5′-ATGACTCGAGAGTGGCTAACGGCAACATATC) and inserted between the SacI and XhoI (NEB) restriction sites of pRS404 ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...