Labshake search
Citations for New England Biolabs :
701 - 750 of 4925 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate Unlab. Dehp Metabolite V ;100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 100 Units of ligase (M0202M, NEB)) ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 U PNGase F (New England Biolabs) was lyophilized (for up to 5 μg trimer) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 µg DNase I (NEB, M0303S). Cells were lysed using a Branson Sonifier (duty cycle ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... RNase inhibitor (1:100 dilution, NEB, M0314L), protease inhibitor (1 tablet per 10 mL ...
-
bioRxiv - Microbiology 2020Quote: ... or RNAse A/T1 (NEB, 100 Units) for 5min at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of amylose resin (NEB E8021S) is equilibrated with 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... and 100 units of DraIII-HF (NEB) for 8-10h at 37° C ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1:100 proteinase K (NEB P8107S)) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.6 uL 100 mM dithiothreitol (NEB, #B1034A), and water to a total volume of 24 uL ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µL dATP (100 mM) (NEB, N0446S), 1 µL SUPERase-In ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 U PNGase F (New England Biolabs) was lyophilized ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA markers of 100 bp ladder (NEB) and 1 kb ladder (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 U of Exonuclease I (ExoI, NEB) were added to the PCR mix and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 DNA polymerase (NEB), 1 μL of Klenow DNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl 10X CutSmart buffer (NEB B7204S) and 0.5 µl BbsI or BsaI_HFv2 (the enzyme used for the cloning reaction) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 mM sodium orthovanadate (New England Biolabs), and 10 mM sodium fluoride (Sigma-Aldrich) ...