Labshake search
Citations for New England Biolabs :
801 - 850 of 4933 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 U EcoRI-HF (cat. no. R3101S, New England BioLabs), and ultrapure water ...
-
bioRxiv - Microbiology 2020Quote: ... in the presence of 20 U RNase inhibitor (M0314L, NEB) for 60 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Bovine serum albumin (BSA, 20 mg/ml, New England Biolabs) was added at a ratio of 5 -10 µg BSA per 1 µl of v-particle stock to all binding reactions to suppress non-specific binding of protein to the v-particles ...
-
bioRxiv - Bioengineering 2021Quote: ... NaCl 20 mM) with 200 μM of each dNTPs (NEB), 0.1% of Bst 2.0 WarmStart® DNA Polymerase (8,000 U/ml) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 µL of 20 mg/mL BSA (New England Biolabs) and 3.5 µL of 5 Weiss U/µL T4 DNA Ligase (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat. No. M0646M) was placed in the bottom of a 0.25 ml PCR tube ...
-
bioRxiv - Microbiology 2021Quote: ... Each 20 uL reaction contained 1X Thermopol Reaction Buffer (NEB), 125uM dNTPs ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μL DpnI enzyme (20 U, New England Biolabs #R0176L) was added to the 25 μL PCR mixture immediately after the final extension and incubated at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20 µl of the ThermoPol Buffer (New England Biolabs, # B9004S) was added to the samples and boiled for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 20–27 and the NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... was added and incubated with 20 units ExoI nuclease (NEB) for 1 h at 37°C before purification with 42 μl AMPure beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2021Quote: ... 4.25 μl EnGen Cas9-NLS (20 μM, New England Biolabs), 2.7 μg sgRNA at 37°C for 10 min.
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by addition of 20 µl of Proteinase K (NEB) and another incubation at 65°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was incubated with 20 ml amylose resin (NEB) pre-equilibrated with lysis buffer for 15 mins before loading onto a gravity flow column ...
-
bioRxiv - Microbiology 2022Quote: ... 20 U of RNase murine inhibitor (NEB, Ipswich, MA, USA), 0.15 µL Cas13a endonuclease (25 nM ...
-
bioRxiv - Genomics 2022Quote: ... 1% bovine serum albumin (BSA) solution (NEB, 20 mg/mL). Nuclei were pelleted at 600 RCF for 5 minutes at 4C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer 5X (NEB, B6058S) and 10 µL Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer 5X (NEB, B6058S) and 10 µL Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µL of 20 µM SpCas9 (New England Biolabs M0646T) were gently mixed with 2 µL of 100 µM gRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The total RNA (20 μg) was subjected to DNaseI (NEB) digestion for 40 minutes as per manufacturer protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and 20 U of Bsal-HF v2 (New England Biolabs), incubated at 37 °C for 16 h to drive the reaction ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Recovered footprints were dephosphorylated in a 15 µL reaction mixture (1 µL T4 PNK (NEB, M0201S), 10X T4 PNK buffer ...
-
bioRxiv - Systems Biology 2021Quote: ... Two-hundred picomoles of the library was PCR amplified over 15 cycles with oligonucleotides Oligo_library_F and Oligo_library_R using Q5 polymerase (New England Biolabs). Amplified DNA was PCR purified (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... Clarified lysates (approximately 15 A260 units) were digested with 800 U/A260 MNase (New England Biolabs) for 1.5 h (25°C ...
-
bioRxiv - Bioengineering 2024Quote: ... comprising 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Biophysics 2023Quote: ... reactions were quenched with the addition of final concentrations of 15% Proteinase K (New England Biolabs) (∼1.2 U ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated for 15 min either with PBS (control) or DNase I (10U) (NEB M0303) or RNase A (2mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µL of the solution was mixed with 15 µL of amylose beads (New England Biolabs). Samples were placed into PierceTM micro-spin columns (Thermofischer ...
-
bioRxiv - Biophysics 2023Quote: ... About 15 pmol of this partial duplex was extended with 1.25 U Taq polymerase (NEB, M0273L) in standard Taq buffer supplemented with 200 μM dNTP by incubation at 65 °C for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 7.5 ng and 15 ng of digested DNA were amplified with 7.5 U φ29 polymerase (NEB) in 1X φ29 buffer (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 15 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...