Labshake search
Citations for New England Biolabs :
701 - 750 of 4933 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10X T4 Ligase Buffer (NEB, Cat #B0202S ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 µL 10x T4 ligase buffer (NEB), and water to 40 µL ...
-
bioRxiv - Genomics 2021Quote: 10 μg genomic DNA from transfected mESCs were digested using 10 μl 10 U/μL NlaIII (NEB, #R0125S) in a 50 μL final volume for 3 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA products were then amplified for 15 cycles of PCR using longAmp Taq (NEB M0287S). During amplification PrepX RNAseq index barcode primers were added for each library to enable multiplexing ...
-
bioRxiv - Biophysics 2021Quote: ... 15 µg of the purified nicked minicircle was incubated with T4 ligase (New England Biolabs) and ligase buffer containing 25 µg mL-1 BSA ...
-
bioRxiv - Genomics 2021Quote: ... The template was PCR amplified (Taq 2x master mix, NEB M0270; Bridge primers; 15 cycles) and size selected by 2% agar gel.
-
bioRxiv - Biochemistry 2022Quote: Lysates were incubated with 15 μL of lysis buffer-equilibrated amylose resin (New England Biolabs) for 1 hour at 4°C with gentle rotation ...
-
bioRxiv - Biochemistry 2022Quote: Oligonucleotides (1.0 μM) were incubated with 15 units of T4 PNK (New England BioLabs, M0202S) and 200 μM 0.555 MBq γ-32P-ATP (185 TBq/mmol ...
-
bioRxiv - Genomics 2021Quote: ... Debranching was performed by incubation with 15 units of T7 endonuclease I (New England Biolabs) for 15 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... extra Biotin-14-dATP was first removed using 15 units of T4 DNA polymerase (NEB) and incubating at 20°C for 4 hours ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA libraries were obtained by PCR amplification for 15 cycles using Phusion DNA polymerase (NEB). After quantification with a micro fluorometer (TBS-380 ...
-
bioRxiv - Molecular Biology 2023Quote: ... a self-packed XK column (Cytiva) with 15 mL of Amylose resin (New England Biolabs) was attached to the HisTrap column ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated for 15 minutes in the presence of concentrated T4 DNA Ligase (NEB-M0202M). Finally the ligated RNA:DNA hybrid was purified using 1X Agencourt RNAClean XP beads ...
-
bioRxiv - Genomics 2024Quote: ... and separated by 15% PAGE using 1X TBE buffer with microRNA marker (NEB, Cat: N2102S) as size maker ...
-
bioRxiv - Molecular Biology 2024Quote: ... A self-packed XK column (Cytiva) with 15 mL of Amylose resin (New England Biolabs) was attached to the HisTrap column ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 15 μl Phusion®High-Fidelity PCR Master Mix (New England Biolabs, Beijing, China), and 0.2 μM forward and reverse primers ...
-
bioRxiv - Biochemistry 2024Quote: ... A self-packed XK column (Cytiva) with 15 mL of amylose resin (New England Biolabs) was attached to the HisTrap column which was then equilibrated into Lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended in spheroblast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 μM beta-mercaptoethanol) and digested with 0.002% 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Microbiology 2024Quote: ... with 5 μl of 5 mM 3’ -desthiobiotin-guanosine triphosphate (DTB-GTP) (NEB product number N0761), 5 μl vaccinia capping enzyme (NEB product number M2080) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µL 10x T4 RNA ligase buffer and 5 µL T4 ssRNA ligase 1 (NEB, USA) were added and the reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM MgCl2) and 10 U Klenow (exo-) polymerase (NEB, M0212S) and α-32P-dCTP (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...