Labshake search
Citations for New England Biolabs :
801 - 850 of 7739 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... for 2 hr at 60 °C and relinearized at the basic dSpacer furan with Ape 1 (15 U; M0282S, NEB, Ipswich, MA) for 2 hr at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Triplicate NEBuilder HiFi assembly reactions were prepared according to manufacturer’s protocols containing ∼2:1 insert to vector as follows: 10 µl of 2X NEBuilder HiFi master mix (New England Biolabs, cat#E2621S), 158.7 ng of DNA fragments ...
-
bioRxiv - Immunology 2021Quote: ... The linearized vector and the synthesized fragment in a 1:2 molar ratio were assembled with the NEBuilder HiFi DNA Assembly Kit (NEB, Ipswich, USA) at 50°C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... TopBP1 full-length cDNA (a kind gift from Lee Zou) was amplified by PCR with primers 1 and 2 using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, CM0530). The forward and reverse primers contain AscI and NotI sites ...
-
bioRxiv - Microbiology 2020Quote: ... and use of a specific barcode from the NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 or 2 (New England Biolabs). Quality and quantity of total RNA ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2, 25 μl NEB Q5 HotStart Master Mix) to the 20 μl beads bound with samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (Suppl. Table 1) were cloned into a pBAD24 with ampicillin resistance using the USER cloning method (New England Biolabs, Table 2). All sequences were cloned including a 10x histidine tag located in the N-terminus for BtuG1-3 and the C-terminus for BtuG2 and all its mutants ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 ng gBlock template and 1 Unit Phusion High-Fidelity DNA polymerase (NEB). The reaction was subjected to a 2-minute initial denaturation at 98 °C ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation for 1 hr with 4 units of DNase I (NEB) at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Molecular Biology 2023Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... The RNA was capped by adding 0.5 mM of 3’-desthiobiotin-GTP (3’-DTB-GTP) (New England Biolabs), 50 units of Vaccinia Capping Enzyme (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed with 3 µl T4 DNA ligase and 3 µl T4 DNA ligase buffer (New England Biolabs, M0202S), and incubated at 25°C overnight (16 hr) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 3’A-tailed using Taq polymerase (NEB) and cloned into TOPO TA vector (Invitrogen ...
-
bioRxiv - Zoology 2019Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Systems Biology 2020Quote: ... After 3’-end healing with PNK (NEB) in T4 RNA ligase buffer for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Then 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biophysics 2021Quote: ... 3’-biotinylated λ-DNA (NEB, Ipswich, MA) was attached to the pre-added lipid bilayer surface (DOPC ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2022Quote: ... adenosine addition at 3’ end (NEB, M0212), ligation of Illumina indexed adapters (NEB ...