Labshake search
Citations for New England Biolabs :
601 - 650 of 7739 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... followed by A tailing with NEB Klenow Fragment (3’−5’ exo-) (New England Biolabs, M0212), adapter ligation with NEB DNA Quick Ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... were assembled using 10 μl of 2× master mix at 50 °C for 1 h according to manufacturer’s instructions (NEB). 5α Competent Escherichia coli (30 μl ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... doner RNA and the complementary splint DNA strand were annealed at a molar ratio of 1: 2: 1.5 in T4 DNA ligase buffer (NEB) by incubation for 3 min at 65°C ...
-
bioRxiv - Neuroscience 2022Quote: ... RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transformation (chemically competent NEB 5- alpha E. coli) were performed according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L). The resulting RNA fragments were used for a reverse transcription reaction using Superscript III Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 5 units/µl RNase H (NEB) were added and samples were incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL RNase H enzyme (5 U) (New England Biolabs) was added and the solution was incubated at 44°C for 1 hr ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μL of PaqCI/AarI activator (5 pmol, NEB, S0532S), 1 μL of 10 U PaqCI/AarI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of one plasmid was digested overnight with 10 units PacI (New England Biolabs) in 20 μL at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...