Labshake search
Citations for New England Biolabs :
751 - 800 of 1083 citations for Nucleoside diphosphate kinase A NDPKA Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was then end-repaired with 20 U of 3’-phosphatase-positive bacteriophage T4 polynucleotide kinase (T4 PNK; New England Biolabs), using conditions recommended by the supplier (1× PNK buffer without ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were manipulated in a final volume of 20 μL labeling mixture containing 1X T4 polynucleotide kinase (PNK) enzyme buffer (NEB), milli-Q water ...
-
bioRxiv - Cell Biology 2023Quote: ... Forward and reverse primers for each sgRNA were annealed by pre-incubation at 37°C for 30 minutes with T4 polynucleotide kinase (PNK; NEB), followed by incubation at 95°C for 5 minutes and then ramp down to 25°C at 5°C/min ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and oligonucleotides crp500F and crp500R (one of which was labeled with [γ32P]ATP by use of T4 polynucleotide kinase (NEB)) ...
-
bioRxiv - Systems Biology 2023Quote: ... 3’ ends of RNA were modified to have 3’ OH groups compatible for ligation using T4 Polynucleotide Kinase (NEB, #M0201L). Beads were incubated at 37°C for 10 minutes with shaking at 1200 rpm on a ThermoMixer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then extracted the RNA from the monosomes with a standard phenol/chloroform protocol and dephosphorylated the RNA by T4 polynucleotide kinase (New England Biolabs). We specifically excised RNAs spanning 28-34nt from the gel ...
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... Equimolar amounts of complementary oligonucleotides were phosphorylated by incubation with T4 polynucleotide kinase in T4 ligation buffer (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: 32P-labelled DNA fragments were generated by PCR using primers labelled with [γ-32P]ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... 20 pmol of the dephosporylated RNA were 5’-end-labeled (20 µCi of 32P-γATP) in a 20 µL reaction for 1 h at 37°C using 1 U polynucleotide kinase (NEB). Labeled RNA was purified on a G50-column (GE Healthcare ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Table S4) were hybridised by slow cooling down from 95-25°C and then phosphorylated using the T4 Polynucleotide Kinase (NEB). The digested plasmid and the hybridised oligonucleotides were ligated using the T4 ligase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... In-vitro-transcription was carried out using the Hi-Scribe RNA transcription kit (New England BioLabs). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ENTR and DEST vectors were generated using Gibson assembly (NEB Builder Hi-Fi DNA assembly #E2621S) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of His-PKR was dephosphorylated using 3,200 units of λ-PPase (New England Biolabs) in 200 μl reaction buffer (50 mM HEPES ...
-
bioRxiv - Plant Biology 2022Quote: ... The HIS tag was removed from the mature sequence of AgLTP24 with enterokinase (NEB, Evry, France) for 16 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicons were end-labeled with [γ-32P] dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science ...
-
bioRxiv - Biochemistry 2020Quote: ... The CIP-treated RNA was then PNK-treated with 1 μL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 μL of [γ-P32]ATP (PerkinElmer ...
-
bioRxiv - Cell Biology 2021Quote: ... and 200 ng of the purified amplicon were end-labeled using 10 µCi of γ-32P ATP (Amersham) and T4 polynucleotide kinase (NEB). The labeling reaction was then desalted on a G-25 spin column and further precipitated with 70% ethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... The gRNA template was generated using a forward and reverse oligonucleotide (IDT, HPLC purity) containing BbsI overhangs that were annealed and phosphorylated using T4 Polynucleotide kinase (PNK) (New England Biolabs, M0201S). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... corresponding to both strands of the 35S rRNA promoter from positions −180 to −110 and −110 to −40 were end-labelled using [γ-32P]ATP and T4 polynucleotide kinase (New England Biolabs) and purified on a 10% acryl/bisacrylamide ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products or annealed oligonucleotides were prepared as described above and end-labeled with 10 μCi [γ-32P]ATP (Perkin-Elmer) and 10 U T4 polynucleotide kinase according to established protocols (New England BioLabs). Binding reactions included 1 μl (~30 ng ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...