Labshake search
Citations for New England Biolabs :
751 - 800 of 3427 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/ml DNase I (NEB), 1x PhosStop phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
mRNA vaccines and hybrid immunity use different B cell germlines to neutralize Omicron BA.4 and BA.5bioRxiv - Immunology 2022Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... or exonuclease III (NEB, 5 units) were performed on 2 – 3 μg of DNA extracted from virus particles for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μM Mth RNA ligase (NEB), 1 x adenylation buffer (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units DNA Pol I (NEB) with water in a total volume of 2x 20 μL ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL 5′-deadenylase (NEB, M0331S) was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB-5-alpha (NEB C2987) was used for plasmid cloning ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An additional reaction was conducted where 10 µg was digested using 3 µl of EcoRI-HF and 3 µl of mung bean nuclease (New England Biolabs, catalog number: M0250) at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...