Labshake search
Citations for New England Biolabs :
651 - 700 of 3427 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB, R0539L) and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μL rCutSmart Buffer (NEB), and 1 μL DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-decapping (RppH, M0356S; NEB) and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 ng ET SSB (NEB), 4 nM phi29 DNAP in a 100 μl reaction and incubated for 3 h at 30°C ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), 4.13 µL of H2O ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB 5-alpha (NEB) cells stored at −80 °C were thawed on ice and transformed with the ligation mixture according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5 μM NAD+ (NEB) without or with 1mM CaCl2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL rCutSmart buffer (NEB), and 1 µL CspCI (5,000 units/mL ...
-
bioRxiv - Genomics 2024Quote: ... 5-methyl-dCTP (NEB # N0356S), dATP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB 5-alpha cells). Cells were plated onto LB plates containing 50 µg/mL kanamycin (LB-Kan) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (NEB 5-alpha cells). Cells were plated onto LB plates containing 50 µg/mL kanamycin (LB-Kan) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amino acid substitutions were generated with the Q5 site-directed mutagenesis kit (NEB) with specific primers (Supplemental Table 4) ...
-
bioRxiv - Genomics 2023Quote: Nucleic acids (gDNA, 1st strand cDNA) were amplified with Q5 polymerase (NEB, M0491) in 50 µL PCR reactions for 16 cycles with 500 nM landing-pad-specific primers (pDEST_HC_Rec_Bxb_v2_F/R ...
-
bioRxiv - Microbiology 2024Quote: ... Individual amino acid point mutants were generated using a Q5-SDM kit (NEB) using the B1 variant as template.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Immunology 2024Quote: ... 5’RACE PCR reaction mixes contained: 5 µl of Phusion 5X Buffer (New England Biolabs), 0.5 µl of 10 mM dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 pmol were 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (NEB). The labeled oligo was mixed in equimolar concentrations with the unlabeled reverse complement and annealed by heating at 100°C in a water bath followed by slow cooling ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 µg plasmid was digested for 4 h at 37°C with BstXI and XhoI (New England Biolabs). Products were run on a 1% agarose gel for 30 min at 120 V ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µL RNase H (New England Biolabs), 644 µL buffer A and 2 µL DTT (1M) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4 U murine RNase inhibitor (NEB). TMAO was adjusted to pH 7.5 in a 6 M stock solution with HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1 μl 10X NEB 4 buffer (NEB), 0.1 μl 10 mM dCTP and H2O ...
-
bioRxiv - Biophysics 2022Quote: ○ 4 μL Klenow Exo-enzyme (NEB #M0212S) μL
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x Apyrase buffer (NEB) and 1 µl of Apyrase (M0398S ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of 10x r3.1 buffer (NEB), 2 µl of 100µM DTT and 1 µl of NudC (M0607S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 µL 10X CutSmart Buffer (NEB) in a 40 µL reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of Quick CIP (NEB, M0508S) was spiked into the reaction and incubated at 37°C for 30 minutes to dephosphorylate unincorporated dNTPs that may inhibit downstream processes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of T5 Exonuclease (NEB M0663S) was added to the reaction and incubated at 37°C for 30 minutes to remove unassembled products ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10X T4 Ligase Buffer (NEB, Cat #B0202S ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 µL 10x T4 ligase buffer (NEB), and water to 40 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µL 10x T4 RNA ligase buffer and 5 µL T4 ssRNA ligase 1 (NEB, USA) were added and the reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 μL of CutSmart buffer (New England Biolabs) with 4 μL of sterile water ...