Labshake search
Citations for New England Biolabs :
751 - 800 of 4581 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Immunoglobulin heavy and light chain cDNA was amplified using the Q5 High-Fidelity 2X Master mix (NEB) and pooled forward primers that bind the leader sequences of the variable regions and the reverse primers that bind the first exon of the mu and kappa constant regions ...
-
bioRxiv - Genetics 2023Quote: We performed n=30 PCR1 reactions per sample using Q5 High Fidelity 2X Master Mix (NEB #M0429S) with 10 ug of genomic DNA to maintain ≥1000X representation ...
-
bioRxiv - Genetics 2023Quote: ... The purified DNA was then amplified by PCR using NEBNext HiFi 2x PCR Master Mix (NEB M0541S), and the resulting library was purified using 1.3X SPRI purification (Omega Bio-Tek ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were amplified by PCR with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs #174M0541S) for 9 cycles in 96-well Thermal cycler (Biorad ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... wild-type or mutant VPS35L sequences were amplified using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... All other site-directed mutagenesis was carried out using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: NRG1-VII was amplified using the LongAmp® Taq 2X Master Mix (New England Biolabs; Cat #: M0287S) and the specified primers (Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each well was then supplemented with 6.4 µL of ligation mix (220 µL of 2X Instant Sticky Master Mix (NEB, #M0370, Ispwich, MA), 352 µL 5X Quick Ligase Buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each well was then supplemented with 6.4 µL of ligation mix (220 µL of 2X Instant Sticky Master Mix (NEB, #M0370, Ispwich, MA), 352 µL 5X Quick Ligase Buffer (NEB ...
-
bioRxiv - Immunology 2021Quote: ... Master mix preparation and cycling conditions were realized with Luna® Universal qPCR Master Mix kit (cat. n° M3003E, NEB, New England Biolabs, Ipswich, MA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Realtime PCR is conducted following manufacturer standard protocol (Luna Universal qPCR Master Mix, NEB Inc). Sybr green RT-PCR primers used in this study is listed in Table 1.
-
bioRxiv - Genetics 2020Quote: ... diluted cDNA samples were amplified by Luna Universal Probe qPCR Master Mix (New England Biolabs) using specific TaqMan Gene Expression Assay (SOX13 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were performed in triplicate with the Luna Universal qPCR Master mix (New England Biolabs) in a total volume of 10 μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions (10 μl) were performed Luna® Universal qPCR Master Mix (New England Biolabs, M3003X). mRNA abundance for each gene was determined relative to GAPDH mRNA using the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2023Quote: Quantitative (q) RT-PCR was carried out using the Luna Universal qPCR Master Mix (NEB) in the CFX384 Real-Time system (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... qRT-PCR reactions were conducted using the Luna Universal qPCR Master Mix (New England BioLabs) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... following protocols for the Luna® Universal Probe qPCR Master Mix (New England Biolabs, M3004). Each 20 µL reaction mix included 10 µL master mix ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR was performed with Luna® Universal qPCR Master Mix (New England Biolabs M3003). The following primer sequences were used ...
-
bioRxiv - Microbiology 2024Quote: ... for cellular genes or the Luna universal probe qPCR Master Mix (New England Biolabs, M3004) for the viral transcripts ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR reactions were prepared using the Luna® Universal qPCR Master Mix (NEB). Reactions were run and data analyzed using the QuantStudioTM 7 Flex Real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 10-µl reactions contained: 5 µl Luna Universal qPCR Master Mix (New England Biolabs), 0.25 µl forward primer (10 µM) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 2nd generation (eggs) was determined by qPCR following the Luna® Universal qPCR Master Mix Protocol (M3003, New England Biolabs) using 2 μl of DNA template ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was diluted 1:25 in water and used as template for RT-qPCR using the Luna Universal qPCR master mix (NEB M3003S). Primers used are listed in Supplementary Table 3 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1.5ul of the resulting cDNA was used as template in 20ul scale qPCR reactions using Luna Universal qPCR master mix (New England Biolabs M3003) with forward primers specific to the microRNA of interest and a universal reverse primer ...
-
bioRxiv - Molecular Biology 2024Quote: RT-qPCR was performed (in triplicate) using the Bio-Rad cycler CFX 96 and the Luna universal qPCR master mix (NEB, M3003X). Gene expression levels were normalized to housekeeping genes EF1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... the inserts and the plasmids were mixed with Gibson master mix 2x (100μL 5X ISO Buffer, 0.2 μL 10,000 U/mL T5 exonuclease (NEB #M0363S), 6.25 μL 2,000 U/mL Phusion HF polymerase (NEB #M0530S) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We then used a standard PCR reaction (Table S7; Q5 High Fidelity 2X Master Mix, New England Biolabs) to amplify DNA from an E ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fill-in reaction consisted of a 25 μl Phusion High-Fidelity Master Mix 2X (New England Biolabs), 23 μl of water and 1ul of each oligo at a concentration of 10 μM ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Genetics 2020Quote: Unless indicated otherwise PCRs were performed with the Q5 Hot-start 2x master mix (New England Biolabs (NEB)) and cloning was performed using the In-Fusion HD cloning kit (Takara Bio ...
-
bioRxiv - Genetics 2020Quote: Unless indicated otherwise PCRs were performed with the Q5 Hot-start 2x master mix (New England Biolabs (NEB)) and cloning was performed using the In-Fusion HD cloning kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.3 μL of annealed oligonucleotides with 0.5 μL of 2x Instant Sticky-end Ligase Master Mix (NEB) and immediately placing the plate on ice ...
-
bioRxiv - Synthetic Biology 2021Quote: ... elegans codon adaptor.[48] PCRs were carried out using Q5 2x Hot-Start Master Mix (New England Biolabs). PCR and digestion products were recovered from agarose gels following electrophoresis using the Zymogen Gel Recovery Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 µL of Gibson Master Mix 2X(100μL 5X ISO Buffer, 0.2 μL 10,000 U/mL T5 exonuclease (NEB #M0363S), 6.25 μL 2,000 U/mL Phusion HF polymerase (NEB #M0530S) ...
-
bioRxiv - Bioengineering 2022Quote: ... ATGTGGGCCCGGCACCTTAA were used to amplify the pool using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplification of target regions was performed from 500ng of gDNA using Q5 High-Fidelity 2X Master Mix (NEB) and primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was used as template in PCR reactions containing the Taq 2X Master Mix (New England Biolabs) and 5 μM of MP2- and scorpine-specific primers (Table S7) ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Developmental Biology 2021Quote: ATAC-seq library was amplified from 20μl tagmented DNA with 25μl 2x Phusion PCR master mix (NEB, 28006) and 0.625μl of each 100mM library primers ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification of DNA for generating assembly products was performed using Q5 DNA Polymerase 2x Master Mix (NEB, USA) with 3% DMSO ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl tagmentation product was mixed with 20.4 μl Q5 High-Fidelity 2X Master Mix (NEB, Cat.No. M0492L), 0.4 μl SuperScript II reverse transcriptase ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplification was performed for 15 cycli using the NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541), followed by a 0.8x beads clean-up ...