Labshake search
Citations for New England Biolabs :
7901 - 7950 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were prepared according to NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, U.S.A.) followed by single end sequencing on a HiSeq3000 to produce 2-3 Gb data per sample ...
-
bioRxiv - Microbiology 2020Quote: ... RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs; Ipswich, MA, USA) and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Library quality was assessed using an Agilent Tapestation 4200 instrument and quantity determined by qPCR using an NEBnext library quantification kit (NEB). Libraries were sequenced as described previously (43 ...
-
bioRxiv - Microbiology 2021Quote: A plasmid was created for each gene of interest (GOI) using the modified pSAG plasmid template and the Q5 Site-Directed Mutagenesis Kit (NEB) by following the manufacturer’s protocol with a few adaptations ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reaction products were used as a template for the in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit, England Biolabs) and purified ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification-free indexed Illumina libraries were prepared (9) using the NEBNext Ultra II DNA Library Prep kit (New England BioLabs). The libraries were quantified using the Accuclear Ultra High Sensitivity dsDNA Quantitative kit (Biotium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina in combination with the Poly(A) mRNA Magnetic Isolation Module (#E7760, #E7490, NEB) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing libraries were prepared using the NEB ULTRA kit following manufacturer’s instructions for genomic DNA library construction and using methylated adaptors (NEB E7535S). Adaptor-ligated DNA was isolated by 2% agarose gel electrophoresis (350–400 bp) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were engineered to lack the guide sequence and were assembled from PCR products by Gibson assembly (Gibson Assembly Master Mix kit, New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by 7 PCR cycles and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Plant Biology 2021Quote: ... 135-160 and 161-206 aa were deleted from the BD-AtCGL160 vector using a site-directed mutagenesis kit (NEB). Primers are listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were produced from 1250ng total RNA using NEBNext Ultra II RNA Library Prep Kit (NEB Cat#E7770S) following manufactures protocol with the following modifications ...
-
bioRxiv - Genomics 2020Quote: ... We added Illumina TruSeq adaptors using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Point mutations (K66E and K166A) on F-BAR-EGFP were produced by the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). Identity of plasmids was confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Fragments between ∼1 kb and ∼8 kb were size selected by excision with a clean razor blade and DNA was purified from the agarose by a silica column-based gel extraction kit (New England Biolabs, cat#T1020S ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was then cloned into pTH19 linearized with BamHI and HindIII using the NEBbuilder assembly kit (New England Biolabs). The plasmid was transformed into yeast as described previously 71 selecting for transformants on media lacking uracil.
-
bioRxiv - Neuroscience 2021Quote: ... The coding sequence of GluN2A and GluN2B point mutations for sgRNA resistant plasmid (GluN2A: AGCCACGACGTGACAGAACGCGAACTT to AGTCACGACGTGACTGAGAGAGAACTT; GluN2B: ATGTCTGACCGGAAGATCCAGGGG to ATGTCTGATCGTAAGATTCAAGGA) were generated by Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... The resulting fragment was cloned into the BamHI-NcoI sites of plasmid pGFP-phleo using the NEBuilder DNA assembly kit (New England Biolabs). In this plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Whole DG libraries for bulk RNAseq were generated with the NEBNext Ultra II Directional RNA Library prep kit (New England Biolabs). The Clontech SMART-Seq HT (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... Library preparation for Illumina sequencing was performed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and a minimum of 5 ng of RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the product was inserted into a lentiviral expression vector (pSIH-H1) containing CMV promotor using NEBbuilder HIFI kit (NEW ENGLAND Biolabs). To co-express GFP-actin and mCherry-KDEL ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified then assembled with pMQ30MRR1-L1191H+Q1197* (linearized with PvuI-HF) using the NEBuilder HiFi DNA Assembly cloning kit (New England BioLabs). To remove an unexpected nonsynonymous mutation in pMQ30MRR1-Q1197* ...
-
bioRxiv - Microbiology 2020Quote: ... using HiScribe T7 Quick High Yield RNA Synthesis Kit according to the manufacturer’s protocol (New England BioLabs Inc, NEB #E2050). The amplified RNA was than purified using Monarch RNA Cleanup Kit (New England BioLabs Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... A C-terminal V5-tag was added and the construct was subcloned into the pCAGGS vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). Likewise ...
-
bioRxiv - Microbiology 2020Quote: DNA probes were synthesized via PCR with Q5 high-fidelity polymerase (Thermo) and purified with Monarch PCR Cleanup Kit (NEB). 75ng probe A/probe B and 150ng probe C/probe D were added to increasing concentrations of protein (4% ...
-
bioRxiv - Microbiology 2020Quote: The SARS2-CoV-2 vaccine candidates were cloned by combining the S cDNA (obtained after PCR on overlapping synthetic cDNA fragments; IDT) by a NEB Builder Cloning kit (New England Biolabs) into the pShuttle-YF17D backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... The Drosophila G269E and I307N mutations were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswitch, MA). Mutagenesis primers were designed using the “substitution” feature in NEBaseChanger v1.2.9 (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... NA and NP RNA were synthesized using a HiScribe T7 in vitro transcription kit (New England BioLabs, Ipswich, MA, USA) and incubated with 3D8 scFv purified protein (0.5 μg ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sheared genomic DNA was prepared for sequencing using a NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) with an additional PCR step to amplify for transposon containing fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting amplicons from each replicate/strain were cleaned up using the Monarch PCR & DNA Cleanup kit (New England Biolabs). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... Mutations identified in EA6 patients were introduced into hEAAT1 plasmid DNA using Q5 site-directed mutagenesis kit (New England Biolabs). Purified plasmid DNAs were sequenced using Big Dye Terminator (BDT ...
-
bioRxiv - Neuroscience 2021Quote: ... Strand-specific RNASeq libraries were created using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #6420L ...
-
bioRxiv - Microbiology 2020Quote: ... library prep was conducted by the standard ≥100 ng protocol from the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB). For insertion junction sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... This insertion junction sequencing protocol has also been tested successfully with the ≤ 100 ng protocol of the NEBNext Ultra II FS DNA Library Prep Kit (NEB) and the KAPA HyperPlus Kit (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... After elution in 5 ml of elution buffer the extracted raw DNA was concentrated on a silica column from the Monarch Genomic DNA purification Kit from NEB.
-
bioRxiv - Cancer Biology 2021Quote: Libraries were prepared from total RNA using the NEBNext Ultra II Directional RNA-Seq Kit (NEW ENGLAND BioLabs, Inc., UK). The isolation of mRNA was performed using the Poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared from total RNA using the NEBNext Ultra II Directional RNA-Seq Kit (NEWENGLAND BioLabs, Ipswich, MA, UK). Additionally ...
-
bioRxiv - Microbiology 2021Quote: ... The V1-V2 region of the 16S rRNA genes was amplified with Q5 High-Fidelity Polymerase Kit (New England Biolabs). (F’:AATGATACGGCGACCACCGAGATCTACAC-TATGGTAATT-CC-AGMGTTYGATYMTGGCTCAG ...
-
bioRxiv - Neuroscience 2020Quote: ... pSico Nectin-3-shRNA and scramble-shRNA constructs were altered before transfection to artificially replicate Cre-excision using site-directed mutagenesis (Q5 site directed mutagenesis kit: New England Biolabs). The GFP-stop sequence and one loxP site were removed from pSico using the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of DNase treated RNA was then taken for cDNA synthesis using the Protoscript I first strand cDNA synthesis kit (New England Biolabs). Selected genes were amplified by quantitative real time PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and used to generate a strand-specific library using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Nascent RNA-seq was conducted as previously described (Crump et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Library preparation was performed at the University of Texas Genomic Sequencing Facility using the NEBNext Small RNA library preparation kit (E7330, New England Biolabs). Samples were prepared with 14 cycles of PCR and the final product was size selected using a 3% gel cassette on the Blue Pippin instrument (Sage Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... — Primers A995 to A998 were designed to make point mutations of ponA2 as shown in Supplementary Table using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). After mutations were confirmed by sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... The extracted RNA was then used to synthesize cDNA using ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Physiology 2022Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amino acid substitutions and domain deletions were made using either Gibson assembly or the Q5 Site-Directed Mutagenesis Kit (NEB). Isogenic single and double mutant strains were generated via haploid mating ...
-
bioRxiv - Neuroscience 2022Quote: ... Adaptors from the LSK-109 sequencing kit (Nanopore) were then ligated onto 42ul of pooled CRISPR cleaved DNA using NEBNext Quick T4 Ligase (New England BioLabs) and incubated at room temperature for 20 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... mutations of interest were introduced into the pMT-Ed::GFP::DlgPDZ3-SH3-HOOK-GUK plasmid (Garcia et al., 2014) using the NEBaseChanger site directed mutagenesis kit as directed by the manufacturer (NEB). To generate the cytosolic pMT-GFP: ...