Labshake search
Citations for New England Biolabs :
7851 - 7900 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Set8RG and Set8RGHL were constructed using site-directed mutagenesis using the Q5 Site-directed Mutagenesis kit on pDEST w+ attB Set8WT (NEB E0554S). KMT5A ...
-
bioRxiv - Biochemistry 2022Quote: ... E7490] from 1μg of total RNA for RNA library preparation and sequencing using NEBNext Ultra Directional RNA Library Preparation Kit for Illumina (New England Biolabs, E7420S) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... 50 mL cell culture were grown in LB to stationary phase and processed with the NEB Monarch genomic DNA purification kit (NEB #T3010). For genomic DNA extraction of E ...
-
bioRxiv - Microbiology 2022Quote: ... These three PCR products were assembled with a double digested pUC19 (PstI and EcoRI) using a NEBuilder HiFi DNA Assembly kit (New England Biolabs, USA), which resulted in the vectors pΔmucG ...
-
bioRxiv - Plant Biology 2022Quote: ... and LCM cell sample collections (ME, TAP, and OSC) was performed using the Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Quantitative PCR was performed using TaqMan primers synthesized by Integrated DNA Technologies (Table S2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were prepared from 10ung of RNA from each sample using the NEBNext Ultra kit (New England BioLabs, Ipswich, MA, USA). Samples were sequenced on an Illumina HiSeq 4000 with a 75ubp paired-end read ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 sorted cells were collected into individual wells of 96-well plate containing 5 μl of lysis buffer of NEB Next single-cell low input RNA library prep kit for Illumina (New England Biolabs #E6420). Plates were frozen immediately on dry ice and stored at −80 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... All CC mutants were generated from untagged WT SUN1 and SUN2 constructs by PCR-mediated mutagenesis (NEB site directed mutagenesis kit) (Table S1).
-
bioRxiv - Biochemistry 2022Quote: mRNA synthesis via in vitro transcription was performed using linearized plasmid DNA using High Scribe T7 Polymerase HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 100 mM NTPs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... apterus libraries were prepared using the NEBNext® Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, United States) at the Berlin Center for Genomics in Biodiversity Research (BeGenDiv) ...
-
bioRxiv - Genetics 2022Quote: ... RNAseq libraries were prepared with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs Inc., Ipswich, MA) and sequenced with the Illumina HiSeq instrument (Illumina Inc. ...
-
bioRxiv - Cancer Biology 2022Quote: ... The paired-end libraries were prepared using a NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA libraries were made using the NEBNext Ultra II Directional RNA library Prep Kit for Illumina using the established protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB#E7490). We used Rapid Run OBCG single read 50 bp on the Illumina Hi-Seq 2500 system to sequence these libraries with 2 technical replicates for each time-point and genotype ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired-end libraries of DNA were constructed by the NEBNext Ultra II DNA Library Prep for Illumina Kit (New England Biolabs; E7645L) with 2 × 150 bp with average insert size ~900 bp and sequenced on a NovaSeq 6000 platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification of the replication of each mutant versus the reference was performed using Luna® Universal Probe One-Step RT-qPCR kit (New England BioLabs) containing 3uL of total RNA ...
-
bioRxiv - Developmental Biology 2020Quote: High-throughput sequencing libraries from ChIP and input DNA were prepared using the NEBNext Ultra DNA Library Prep Kit (New England Biolabs, E7370S). During library preparation ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (New England Biolabs, MA, USA) and index codes were added ...
-
bioRxiv - Immunology 2020Quote: ... Purified DNA was subjected to ChIP-Seq library preparation with NEBNext Ultra II DNA Library Prep Kit for Illuumina (NEB, #E7645) and sequenced by paired-end 75-bp sequencing on Next-Seq550 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was assessed using the Agilent Bioanalyzer and appropriate samples were used for NGS library preparation with the NEBNext Ultra II Directional RNA kit (NEB E7760) and sequenced with 50 bp paired-end reads and 30 mio reads per sample on the Illumina HiSeq 2500 ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Developmental Biology 2021Quote: ... High-throughput sequencing libraries from ChIP and input DNA were prepared using NEBNext Ultra DNA Library Prep Kit (New England Biolabs, E7370S). During library preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... and libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB; E7760), as directed by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... excised and gel extracted using the Monarch DNA Gel Extraction Kit following the manufacturers’ instructions (New England BioLabs; Ipswitch, MA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... from each sample were used to construct the DNA libraries using a NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of rRNA-depleted RNA was subsequently used for library preparation using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs, E7420S) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: Whole-genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl-seq kit (New England BioLabs®, Inc.) following the protocol for standard insert libraries (370-420 base pairs) ...
-
bioRxiv - Microbiology 2021Quote: ... the purified DNA was used as library construction with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645L). High-throughput sequencing was carried out using Illumina Hiseq-PE150 by Novogene Corporation (Beijing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 ng rRNA-depleted RNA from each nuclear fraction was used with the NEBNext Ultra II Directional library kit (NEB E7760S) to prepare RNA-seq libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were constructed with the NEBNext RNA Ultra II Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, United States) from 1 µg of purified RNA according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Library preparation of immunoprecipitated DNA fragments was performed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... coli culture grown in LB supplemented with 100 μg/ml carbenicillin (LB+CA100) via miniprep kit (New England Biolabs, cat#T1010S). The plasmid was transformed into chemically competent E ...
-
bioRxiv - Molecular Biology 2019Quote: ... insertion of GLuc and chimera of CBD were introduced into the flavivirus NS1 constructs (DENV, ZIKV, YFV) using Q5® Site-Directed Mutagenesis Kit (NEB) used according manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and Thr205Ala) were introduced individually to ItypOR46 in pcDNA5™/TO using the Q5 Site-Directed Mutagenesis kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: NRSF/REST fragments as well as the linearised backbone vector were assembled in an isothermal Gibson assembly reaction (Gibson Assembly® Cloning Kit, New England BioLabs) following the manufacturer’s instructions (Figure S4C ...
-
bioRxiv - Neuroscience 2021Quote: ... non-stranded cDNA libraries were constructed using poly(A) mRNA enrichment and the NEBNext Ultra™ II RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, E7770S). RNA and library qualities were confirmed using Qubit Flourometric Quantification (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s instructions and sequenced using HiSeq2500 (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by cDNA generation (NEB 1st strand and NEB 2nd strand ultra directional Kits; New England BioLabs, Frankfurt am Main, Germany). Libraries were prepared using a NEBNext Ultra DNA kit (New England BioLabs ...
-
bioRxiv - Genomics 2020Quote: ... Novogene prepared a PCR free Illumina sequencing library using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA), with the manufacturers protocol modified to give a 500 bp – 1 kb insert size ...
-
bioRxiv - Cancer Biology 2020Quote: ... and bar-coded libraries were constructed using the NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (NEB, Ipswich, MA). Libraries were pooled and single end-sequenced (1×75 ...
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2021Quote: ... RNA passing quality control was converted to a sequencing ready library using the NEBNext Ultra II Directional RNA library kit with polyA selection as per the manufacturer’s instructions (NEB, Ipswich, MA). The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems ...
-
bioRxiv - Microbiology 2021Quote: A549 cells were infected with PR8 at a MOI of 5 and lysates were collected every two hours post infection (hpi) until 8 h RNA extraction was performed with Monarch total RNA Miniprep kit (New England Biolabs GmbH) according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... was used to generate RNA-seq library using NEBNext Ultra Directional RNA library Prep Kit for Illumina (New England BioLabs, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... We isolated the total RNA from 2×107 cells using a Monarch Total RNA Miniprep Kit (T2010, New England Biolabs, MA) as described by the manufacturer with an additional 30-minute ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ul of this was then used as an input for T7 polymerase mediated In vitro Transcription (IVT) using the NEB HiScribe T7 High Yield RNA Synthesis Kit (NEB, # E2040S). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: Reporter gene fusions for cis-regulatory analysis of terminal identity genes were made using either PCR fusion (Hobert, 2002) or Gibson Assembly Cloning Kit (NEB #5510S). Targeted DNA fragments were fused (ligated ...