Labshake search
Citations for New England Biolabs :
7701 - 7750 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: Libraries for DNA sequencing were prepared according to the instructions accompanying the NEBNext DNA Ultra II kit (catalog # E7645S; New England Biolabs, Inc). Libraries were sequenced on the NextSeq 500 following the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2019Quote: ... TR standards for northern blots were in vitro transcribed from PCR products using the HiScribe™ T7 high yield RNA synthesis kit (New England Biolabs). Band intensities were quantified using ImageQuant TL 8.2 (GE Healthcare Life Sciences).
-
bioRxiv - Molecular Biology 2019Quote: The purified PCR products were used as templates for in vitro transcription of antisense and sense ssRNA by using the HiScribe™ T7 In Vitro Transcription Kit (NEB #E2030S ...
-
bioRxiv - Molecular Biology 2020Quote: ... SpCas9 was amplified by PCR and the PCR product was assembled with a −8.7 kb backbone construct using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, USA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Modification of this gene was carried out by Gibson assembly using oligonucleotides sourced from Eurofins or using the Q5® Site-Directed Mutagenesis Kit from NEB. Designed apoproteins were expressed in E ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2020Quote: ... Qualified RNA per sample was used to generate sequencing libraries by NEBNext Ultr RNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... First strand cDNA synthesis was performed using an oligodT and the ProtoScript Taq RT-PCR kit (New England Biolabs, Ipswich, MA). Second strand synthesis was performed with the NEBNext mRNA Second Strand Synthesis Module kit – E6111S (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: Synthesis of cDNA was performed using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs; cat. no. E7420) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: The Illumina paired-end adaptor was ligated to ∼500 ng purified sonicated AluI-digested DNA using the NEBNext Ultra DNA library kit for Illumina (New England Biolabs E7370) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 40 ng of the fragmented DNA was used to make Illumina sequencing libraries with the NEB Next DNA library kit for Illumina (New England Biolabs, www.neb.com). For 3 samples (family 1 mother 10 month ...
-
bioRxiv - Genomics 2019Quote: ... Stranded RNAseq libraries were prepared from poly(A) selected RNA with the NEBNext Ultra RNA Library Prep Kit (NEB, Cambridge, MA) and sequenced across two Illumina HiSeq lanes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The gRNAs targeting SERPINB5 and Tnf were created by site-directed mutagenesis of pLenti-Il33gRNA6-puro using primers listed in Supplementary Table S2 and the Q5® Site-Directed Mutagenesis Kit (NEB) according to manufacturer protocol ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing adapters and oligonucleotides used for PCR barcoding were from the NEBNext Multiplex Oligos for Illumina Kit (New England Biolabs, NEB). Prior to PCR amplification of the library ...
-
bioRxiv - Zoology 2019Quote: ... The libraries were synthesized using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (E7760, New England BioLabs, Ipswich, Massachusetts, USA). Paired-end sequencing was carried out using Illumina HiSeq 2500 instrument (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... The annealed oligos were used as the templates for in vitro transcription (IVT) using the HiScribe™ T7 High Yield RNA Synthesis Kit (Cat. E2040S, NEB). After IVT ...
-
bioRxiv - Immunology 2019Quote: IVT was performed using the T7 promoter of the pcDNA3.3_NDG plasmid and HiScribe T7 ARCA mRNA kit with tailing (NEB #E2060S, Ipswich, MA). Whole kit was used with 20 ug DNA following manufacturer’s protocol ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1) using the Q5 site-directed mutagenesis kit from New England Biolabs (NEB, USA). HA-GLUT4 and HA-GLUT1 were extracted using AcsI and EcoRI restriction enzymes and Cutsmart buffer from NEB and the agarose gel extraction kit from Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... These fragments were cloned into the XhoI site of pACYCDuet-1 by a NEBuilder HiFi DNA Assembly kit (New England Biolabs, USA), resulting in the plasmid pEXT06 ...
-
bioRxiv - Microbiology 2019Quote: ... These three PCR products were assembled with a double digested pUC19 (PstI and EcoRI) using a NEBuilder HiFi DNA Assembly kit (New England Biolabs, USA), which resulted in the vector pEXT01 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The recoded gene was then synthesized ab initio by Twist Biosciences and assembled into pSB1C3-T7 using the NEB HiFi Assembly kit (NEB# E5520S).
-
bioRxiv - Cancer Biology 2019Quote: ... Paired end strand-specific whole transcriptome libraries were prepared for 16 pairs using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, UK), following rRNA depletion with NEBNext rRNA Depletion Kit or Ribo-Zero Gold ...
-
bioRxiv - Molecular Biology 2020Quote: ... Two gRNAs targeting the second and the last exon of spel1 were cloned with the Gibson Assembly® Cloning Kit (New England Biolabs) into a BbsI (10,000 units/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... EcoR1 and Kpn1) right after SV40 promoter and immediately before firefly Luc using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... EcoR1 and Kpn1) right after SV40 promoter and immediately before firefly Luc using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol.
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of cDNA was used for the Illumina sequencing library construction using NEBNext Ultra DNA Library Prep Kit (NEB, E7645). Paired ends sequencing was performed on NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of DNA was used for the library construction using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645). Sequencing was performed on NextSeq500 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis of the fHbp SP in pGCC4fHbpL91543 to repair SNP1 and SNP2 individually was performed using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2019Quote: ... ErCas12a Strataclone was subjected to site directed mutagenesis with ErCas12a SDM remove BsaI Top and ErCas12a SDM remove BsaI bottom with the Q5 SDM kit (New England Biolabs #E0554S) to generate ErCas12a Strataclone no BsaI ...
-
bioRxiv - Biochemistry 2020Quote: Mutated variants of AtXOAT1 were generated by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions using pGEN2-DEST-AtXOAT1 as a template ...
-
bioRxiv - Biochemistry 2019Quote: RNA was produced by in vitro transcription (IVT) using the HiScribe T7 High Yield RNA Synthesis Kit (New England BioLabs, E2040S). DNA templates for the IVT reaction were produced by annealing complementary DNA oligos (IDT ...
-
bioRxiv - Genetics 2019Quote: ... The Mod5MTS-M12A-TRIT1 construct was generated by site directed mutagenesis using the Q5® Site-Directed Mutagenesis kit (New England Biolabs) and Mod5MTS-TRIT1 and forward and reverse primers ...
-
bioRxiv - Bioengineering 2019Quote: ... Unlabeled tracrRNAs were synthesized by IDT or through in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, NEB) using DNA templates containing a T7 promoter binding sequence and full length tracrRNAs ...
-
bioRxiv - Genomics 2020Quote: ... ChIP-seq libraries were prepared for sequencing using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB, #E7103). The detailed ChIP-seq protocol can be found in Supplementary materials.
-
bioRxiv - Genomics 2020Quote: ... Libraries for ChIP-seq were prepared with the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, NEB #E7370) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: RNAseq libraries were prepared with the “protocol for library preparation of Intact RNA using NEBNext rRNA depletion kit (Bacteria) (NEB#E7850, NEB#78860) and NEBNext Ultra II directional RNA library prep kit for Illumina (NEB#E7760 ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were assembled and cloned into the pW8-dhdWT vector (Tirmarche et al., 2016) previously digested by KpnI and BamHI using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, #E5520S). dhdΔDRE transgene was integrated in the PBac{attP-3B}VK00031 platform (62E1 ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq libraries were built using the NEB Next UltraII DNA library Prep kit for Illumina (New England Biolabs #E7645S/L) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... as shown in figure S2) were introduced into the ARSA plasmid by using Site-Directed Mutagenesis Kit (Cat. No. E0552s, NEB, USA). The sequences of mutated cDNA vectors were confirmed using the ABI3500 sequencer (Applied Biosystems Inc. ...
-
bioRxiv - Genomics 2021Quote: ... The transcriptome library was prepared using NEB ultraII RNA library preparation kit as per the manufacturer’s recommended protocol (NEB, MA, USA) and the libraries then underwent size selection ...
-
bioRxiv - Genomics 2021Quote: ... 1μg of total RNA was used to enrich mRNA using NEB Magnetic mRNA isolation kit according to the manufacturer’s instructions (NEB, MA, USA). cDNA was synthesized and ligated to sequence adapters ...
-
bioRxiv - Genetics 2019Quote: ... Immunoprecipitated DNA was reverse-crosslinked and used to construct high-throughput sequencing libraries using NEBNext Ultra DNA Library Prep Kit (New England Biolabs, E7370). DNA libraries were processed on a Illumina HiSeq machine for single-end sequencing ...
-
bioRxiv - Genetics 2020Quote: ... pREP81-FLAG vector and plasmids carrying wild type and mutated forms of rrp1+ and rrp2+ as well as domains of rrp1+ gene used in the yeast two hybrid system were constructed using the Gibson Assembly® Cloning Kit (NEB). All primers used to amplify gene sequences by PCR are listed in Table S3 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and used this as template to construct DNA libraries using a NEBNext Fast DNA Library Prep Set for Ion Torrent kit (New England Biolabs, Canada). Each sample library contained a unique barcode adapter (NEXTflex DNA Barcodes for Ion Torrent ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic sequencing libraries were prepared directly from one aliquot of each sheared genomic DNA sample using the NEBNext Illumina library preparation kit according to the manufacturer’s directions (New England Biolabs, MA, USA). Samples were then sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina ...
-
bioRxiv - Genomics 2021Quote: This material was used for generating sequencing libraries using the Small RNA library prep Set for Illumina (Multiplex compatible) kit (NEB E7330). Typically ...
-
bioRxiv - Genomics 2021Quote: ... The resulting rRNA-depleted RNA was used for library construction with the NEB ultra II directional RNA-seq kit (NEB E7760). The library was sequenced on illumina Miseq (75 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and a portion corresponding to 1 µg input RNA was converted to cDNA using the LunaScript RT SuperMix cDNA synthesis kit (NEB E3010). 1% of the cDNA was used for each qPCR reaction performed with the Luna Universal qPCR Mastermix (NEB M3003 ...
-
bioRxiv - Genomics 2021Quote: ... The elution product was directly used for second-strand synthesis using reagents from the NEBNext Ultra II Directional RNA Library Prep Kit (NEB E7760). 8 μL of Second Strand Synthesis Reaction Buffer ...
-
bioRxiv - Genomics 2020Quote: ... Following the manufacturer’s instruction 3μg RNA per group was used for sequencing libraries were generated using a NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). The index-coded samples were clustered on a cBot Cluster Generation System using the TruSeq PE Cluster Kit v3-cBot-HS (Illumina ...