Labshake search
Citations for New England Biolabs :
7551 - 7600 of 9715 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by PCR and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Cell Biology 2023Quote: ... were made by non-overlapping mutagenesis following the procedure described in the Q5 site-directed mutagenesis kit (New England Biolabs), using the pSS393 as template and divergent primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The pSS459 plasmid driving the expression of PHOP1-GFP-pch2-nes4A was derived from pSS393 by using the NEBuilder assembly kit (New England Biolabs) and a synthesized gBlock fragment (IDT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Biochemistry 2023Quote: The K164A mutant was made by site directed mutagenesis using wild type LhCE as template with the Q5 Site-Directed Mutagenesis Kit from NEB using following primers:
-
bioRxiv - Microbiology 2023Quote: ... All samples were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760L), with an initial amount of 100 ng total RNA in 12 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Both isoforms were cloned into a pcDNA 3.1 mammalian expression vector using an NEBuilder® HiFi DNA Assembly kit (cat # E5520S, New England Biolabs). We obtained human FAM161A cDNA in p3XFLAG-CMV-7 from Dr ...
-
bioRxiv - Plant Biology 2023Quote: ... pENTR221-Scs6 was used as a template to generate Scs6S793F and Scs6H510V via PCR mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated according to the manufacturer’s instructions: polyA-selected RNA was isolated and libraries were prepared using the NEBNext kit (New England Biolabs, e7500s). Purified libraries were quantified on an Agilent Technologies 2200 TapeStation with a D1000 ScreenTape assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... The products were purified using the Zymo Research kit and eluted with 6 uL water and 1 uL was electroporated into DH10B cells (NEB). Electroporated cells were recovered in 975 uL of LB and plated on LB agar containing carbenicillin (100 μg/ml ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 30 ng of methylated DNA was used to generate the NGS (Next-Generation Sequencing) library by using the NEBNext ULTRA DNA Library Prep Kit for Illumina (New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... an SP6 promoter was inserted upstream of the transcriptional start using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). All plasmids were confirmed by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DNA assembly was performed to join R7-DD and R9-DD to linearised the GFP-cBAK vector using the NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2023Quote: ... in vitro transcription (used in experiments in figures otherwise) from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription in vitro ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA library preparation was performed on total or polysomal RNA using a NEBNext Poly(A) mRNA Magnetic Isolation Module and a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s instructions with 1 μg of RNA as a starting point ...
-
bioRxiv - Immunology 2023Quote: ... The following primers were used to amplify the Mpro sequence from cDNA with the Phusion polymerase kit (New England BioLabs). F:AATAAGGTACCAGTGGTTTTAGAAAAATGG ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mutation for generating BN-CD38Mut was introduced to BN-CD38 with Q5 Site-Directed Mutagenesis kit (New England Biolabs). Both were produced transiently in ExpiCHO cells (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Library construction: The RNA sequencing library was constructed using NEBNext® Ultra II RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-directional sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analyzed on an Illumina NextSeq 550 with v2.5 reagent kits following manufacturer’s protocols.
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified DNA was submitted to NGS library preparation using NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, E765) and sequenced with NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted DNA was used for qPCR or sequencing library preparation with NEBNext Ultra II DNA Library Prep Kit (NEB; E7645) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... beads was fragmented into short fragments using fragmentation buffer and reversly transcribed into cDNA by using NEBNext Ultra RNA Library Prep Kit for Illumina (#7530, New England Biolabs). The purified double-stranded cDNA fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... and CUT&RUN samples from two replicate (two independent CRISPRi clones) using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645, NEB). The manufacture’s protocol was employed with the following changes ...
-
bioRxiv - Biophysics 2023Quote: Illumina sequencing adapters were added by ligation mediated PCR using the NEBNext UltraII DNA Library Prep Kit (New England BioLabs). The libraries were Bioanalyzed on a high sensitivity DNA chip ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ligation product was amplified through 10 reaction cycles to generate a whole genome library (MC library) using NEBNext Ultra II DNA library Prep Kit for Illumina (New England Biolabs) and 750ng MC library was used for exome enrichment ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng DNA was subjected to library preparation using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: PT024 RARα cells were treated as described and total RNA were extracted using Monarch Total RNA miniprep kit (NEB #T2010S) according to manufacturer’s protocol.
-
bioRxiv - Genomics 2022Quote: ... continued with end-repair and adaptor ligation by following the NEBNext® Ultra™ II DNA Library Prep Kit (NEB). Ligated DNA was affinity-purified with Dynabeads MyOne Streptavidin C1 beads (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... crushed tissue from the head and legs of a single larvae was used for DNA extraction with Monarch Genomic DNA Purification Kits (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA was prepared for strand specific sequencing by the Biomedical Research Centre Sequencing Core (UBC, Vancouver) using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and polyA selection (NEB). Libraries were sequenced on an Illumina Miseq machine using 300 cycles ...
-
bioRxiv - Genomics 2022Quote: ... The eluted ATAC-Seq library was cloned into AgeI- and SalI-digested pLenti-STARR using a 3:1 molar ratio (insert:backbone) in a total reaction volume of 100 μL using the NEBuilder HIFI DNA Assembly Kit (NEB #E5520S). The reaction was concentrated to a total of 20 μL in a Reaction Cleanup Kit (Qiagen #28206) ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were then generated using 10 ng of DNA with NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). The quality of the libraries was assessed with Agilent 2100 Bioanalyzer Instrument ...
-
bioRxiv - Genomics 2022Quote: ... the resulting products were firstly ligated with barcodes from the Native Barcoding Expansion kits by using NEB Blunt/TA Ligase Master Mix (New England Biolabs) and then with adapter from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2022Quote: ... and then with adapter from the Ligation Sequencing Kit (SQK-LSK109, Oxford Nanopore Technologies) added by using the NEBNext Quick Ligation Module (New England Biolabs). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... Subsequent steps of RNA-seq were outsourced to Azenta who generated sequencing libraries from polyA-enriched RNA (captured with oligo-dT beads) using the NEBNext Ultra II RNA library prep kit for Illumina (NEB), multiplexed them ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was either carried out using 0.5 μg of RNA with NEBNext Ultra RNA library Prep Kit for Illumina (New England BioLabs, E7530L) or was performed by Novogene Services ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were constructed from ∼2ng DNA and prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Library quality was assessed by Fragment Analyzer NGS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation for high-throughput sequencing was performed on 100 ng of rRNA depleted RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was done with a NextSeq 500/550 High Output Kit v2.5 (150 Cycles) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were constructed by NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB #E7775). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... was used to prepare libraries with the NEBNext Ultra II library preparation kit with unique dual index primers (New England Biolabs). The library quality and quantity were verified by BioAnalyzer DNA 1000 (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... RNA was prepared for sequencing using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760). Sequencing was performed on an Ilumina NovaSeq 6000 instrument equipped with an S4 flow cell generating 150bp paired-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... The two PCR-amplified DNA blocks were inserted into the linearized AAV-TBG vector by Gibson Assembly using an NEBuilder HiFi DNA assembly kit (NEB) following the manufacturer’s instruction.
-
bioRxiv - Cell Biology 2023Quote: pTO-GFP-SNX17 was used to generate an shRNA resistant version of GFP-SNX17 by introducing three silent mutations into the target sequence of the SNX17 shRNA clone 1 construct using the Q5-site directed mutagenesis kit (New England Biolabs). Specifically ...
-
bioRxiv - Cell Biology 2023Quote: Poly(A)+ RNA was isolated from nuclei and whole cells (see C2C12 cell fractionation above) using the Magnetic mRNA Isolation Kit (New England Biolabs). Two rounds of binding ...
-
bioRxiv - Biochemistry 2023Quote: A luminescence based translation inhibition assay was performed using an in-vitro translation PURExpress® Δ Ribosome Kit from (NEB) The constituents of the kit were incubated with 25 ng pMSR DNA template ...