Labshake search
Citations for New England Biolabs :
7501 - 7550 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Illumina sequencing libraries for each genome were constructed using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) using the manufacturer’s protocol with DNA input concentrations of 5-15 ng/µL ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were centrifuged 7,000xg/2min pellet was washed in 1ml of PBS and then resuspended in 400 μl of the resuspension buffer (Monarch Miniprep kit – NEB) containing 50 μg of lysostaphin ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing library was generated using NEB Next® Ultra TM DNA Library Prep Kit for Illumina (NEB, USA, Catalog#: E7370L) following manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... The remaining steps of library preparation were done using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs). Adapters and PCR primers were purchased from New England BioLabs.
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleotide substitution or deletion mutations were designed on the NEBaseChanger online tool and TOPO-cloned using the Q5 site-directed mutagenesis kit (New England Biolabs) according to the standard protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... . Site-directed mutagenesis was performed on 10 ng pET28a(+)-HisPI31wt template with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... The final cleaned-up Hi-C library was used as input material for Illumina sequencing library prep kit (NEB, E7805) with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... These DNA constructs were used as a template to in vitro transcribed RNA using T7 high yield RNA kit (New England Biolabs). The synthesized RNA was DNase treated (TURBODNase) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Constructs were transformed and amplified in NEB 5-alpha Competent E ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.1-FLAG-ZBTB48 WT was used as template for the generation of the constructs with point mutations in the C-terminal arm using the primers in Table S6 and the Q5 Site-Directed Mutagenesis Kit (NEB). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... the pool was subjected to NEBNext FFPE DNA Repair and Ultra II End-prep kits (M6630 and E7546, New England Biolabs). After that ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were constructed using approximately 6 ng of total EV RNA as input material for the RNA sample preparations using the Small RNA Library Prep Set for Illumina kit (New England BioLabs) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... where the band shift due to the insertion of the BSR cassette was confirmed in the case of homologous recombination and purified using a PCR purification kit (NEB), in which the nucleotide sequence was determined (Genewiz) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutants of UFD1-His6 (deletion of amino acids 2-215) and NPL4 (T590L+F591V point mutations) 18 were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: PCR amplification was carried out using a Q5® High-Fidelity DNA Polymerase kit (#M0491L, New England Biolabs, Ipswich, MA) using the following protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Then the sequencing library was generated by the NEBNext® Ultra II DNA Library Prep Kit (New England Biolabs; E7103S) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both isoforms were cloned into a pcDNA 3.1 mammalian expression vector using an NEBuilder® HiFi DNA Assembly kit (cat # E5520S, New England Biolabs). We obtained human FAM161A cDNA in p3XFLAG-CMV-7 from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... All samples were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760L), with an initial amount of 100 ng total RNA in 12 μl ...
-
bioRxiv - Biochemistry 2023Quote: The K164A mutant was made by site directed mutagenesis using wild type LhCE as template with the Q5 Site-Directed Mutagenesis Kit from NEB using following primers:
-
bioRxiv - Biochemistry 2023Quote: ... four cycles of RD were performed using the PureExpress in vitro protein synthesis kit (New England Biolabs, Ipswich, MA, USA) for in vitro transcription and translation ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was obtained by reverse transcription of 0.5 μg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, #E6560S). Three independent biological replicates were prepared for each genotype ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was pre-amplified with pooled barcoded primers before libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) using the AMPure XP reagent (AgenCourt Bioscience ...
-
bioRxiv - Plant Biology 2023Quote: ... pENTR221-Scs6 was used as a template to generate Scs6S793F and Scs6H510V via PCR mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated according to the manufacturer’s instructions: polyA-selected RNA was isolated and libraries were prepared using the NEBNext kit (New England Biolabs, e7500s). Purified libraries were quantified on an Agilent Technologies 2200 TapeStation with a D1000 ScreenTape assay ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of RNA template was equalized for reverse transcription using the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) and random hexamers ...
-
bioRxiv - Microbiology 2023Quote: ... Library preparation was conducted by the standard ≥100 ng protocol from the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) with minor modifications ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by first-strand cDNA synthesis with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligo for Illumina (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: The EYFP reporter constructs for nuclear localization were created by bridging the linearized proGL2:EYFP SR54 binary vector lacking the GL2 cDNA with ssDNA oligos using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs) and oligonucleotides given in Supplemental Table S3 ...
-
bioRxiv - Plant Biology 2023Quote: circRNAs were produced by in-vitro transcription from annealed DNA oligonucleotide templates (Table S2) using HighScribe T7 high-yield RNA synthesis kit (NEB) along with ATP ...
-
bioRxiv - Plant Biology 2023Quote: ChIP-seq libraries were constructed from 100 ng of DNA samples using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Site direct mutagenesis of GPS1 (plasmids pDR-FLIP43 GPS1 and p16-FLIP43 nlsGPS1 (Rizza et al., 2017) was achieved using QuikChange site-directed mutagenesis kit and Phusion high-fidelity DNA polymerase (NEB) following manufacturer protocol resulting in plasmids pDR-FLIP43 GPS2 (for yeast expression ...
-
bioRxiv - Zoology 2023Quote: ... followed by the production of stranded cDNA libraries with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Individual barcodes were applied with NEBNext dual adaptors (New England Biolabs ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ChIP-seq Illumina libraries were prepared for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Following adapter ligation ...
-
bioRxiv - Systems Biology 2023Quote: ... the sequencing library was generated with the NEBNext® Ultra™II Directional RNA Library Prep Kit (New England Biolabs) and paired-end sequencing was processed with the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Bioengineering 2023Quote: ... The sequencing library was generated using NEBNext® UltraTM II DNA Library Prep Kit (New England Biolabs, MA, United States) and sequenced on an Illumina Nova6000 platform generating 250-bp paired-end reads (Guangdong Magigene Biotechnology Co. ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA sequencing libraries were prepared with the NEBNext Ultra II DNA library prep kit according to the manufacturer’s instructions (New England Biolabs, E7645S) and sequenced on the Illumina NextSeq platform with the 75-cycle paired end kit (NextSeq 500/550 High Output Kit).
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from 1 μg of RNA using the ProtoScriptTM M-MuLV Taq RT-PCR kit and random primers (New England BioLabs). Quantitative PCR using SYBR select master mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2023Quote: ... The IVT reaction product was treated with DNase I to remove DNA template and then purified using the Monarch RNA clean-up kit (NEB). RNA concentration was measured using a NanoDrop (ThermoFisher).
-
bioRxiv - Bioengineering 2023Quote: ... The PCR fragment was gel purified and inserted into plasmids pTRC99a and pKI_IS10 (gift of S. Wenk) using HiFi DNA Assembly Cloning Kit (NEB. pZE21) for Gibson cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... The Ct values of samples were determined by quantitative PCR (qPCR) using a Luna Universal Probe One-Step RT-qPCR Kit (cat. #E3006, New England Biolabs) with LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... 3 to 5 ng of RNA from input and corresponding m6A-IPs were used for NGS library production following the protocol NEBNext Ultra II directional RNA library prep kit for Illumina (New England Biolabs), treating samples as rRNA-depleted and fragmented RNAs ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Synthetic Biology 2023Quote: All plasmids used in this study were constructed by Golden Gate cloning using the EMMA cloning platform35 or NEBridge Golden Gate Assembly BsaI-HFv2 and BsmBI-v2 kits (NEB) and are listed in Supplementary Table 1 ...