Labshake search
Citations for New England Biolabs :
701 - 750 of 10000+ citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Immunology 2024Quote: ... 0.5μL 20x WarmStart RT Enzyme Mix (NEB), 0.5μL of target gene specific forward and reverse primers and probe mix as previously described8 ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Biochemistry 2022Quote: ... UPF2L (120-1227) were produced by PCR amplification (primers listed in Supplementary Table S1) using the Phusion High-Fidelity PCR kit (NEB #E0553S) prior to restriction digest and ligation into pPROEX-HTB (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... The remaining DNA was used to amplify fragments of the target site by PCR and amplicons were purified using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions and either sent for 250 bp paired end Illumina amplicon sequencing (Genewiz) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Fusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Molecular Biology 2022Quote: ... Two to three PCR reactions per sample were combined and cleaned-up using the Monarch PCR and DNA clean-up kit (NEB, T1030S). 10-100 ng of DNA from each sample was carried forward for end-repair using the NEBNext Ultra II End repair/dA-tailing Module (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear plasmid fragments were generated by PCR and purified by Monarch® PCR and DNA cleanup kit (New England BioLabs®). Ligations were performed with In-Fusion® enzyme at 50°C for 15 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Custom Nextera PCR primer and the NEBNext High-Fidelity 2x PCR Master Mix (Nextera DNA Library Preparation Kit (New England BioLabs, E7530L) and purified with the Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmid (Monarch® PCR mini-prep kit) and gel extraction kits (Monarch® DNA gel extraction kit) were also obtained from NEB and used according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative PCR was run on the Eppendorf Mastercycler (SybrGreen) using the LUNA Universal qPCR Master Mix (New England Biolabs, Catalog # M3003). Primers used for real-time qPCR can be found in Supplementary Data 5.
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Biophysics 2021Quote: ... Indel frequencies at the SaCas9 target site were assessed via a T7E1 assay with the EnGen Mutation Detection Kit (NEB), using the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... The LAMP reaction in the 2-step LAMP-CRISPR detection was performed using the WarmStart® LAMP Kit (NEB #E1700), using primer concentration described in literature (“Rapid Detection of SARS-CoV-2 Using Reverse transcription RT-LAMP method,” 2020) ...
-
bioRxiv - Microbiology 2020Quote: ... The LPMO and CBH1 amplicons for detection were radio-labelled with [α-32P] dCTP using the NEBlot Kit (NEB, USA) according to the manufacturer’s instructions and used as a probe to determine the copy number of T-DNA integrations in all the transformants.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was subsequently sent for either library preparation and RNA-sequencing to Genewiz or cDNA preparation via a two-step process beginning with Lunascript RT Supermix Kit (#E3010, New England Biolabs). qRT-PCR was performed on cDNA from samples for genes of interest using the Luna Universal qPCR Master Mix (#M3003 ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Genomics 2020Quote: Synthetic SARS-CoV-2 RNA templates were serially diluted and amplified by RT-LAMP using the WarmStart LAMP Kit (NEB). LAMP primers were added to a final concentration of 0.2µM for F3 and B3 ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Samples included 1) cDNA generated from >200nt RNA extracted previously from the 12h embryo sample (LunaScript RT Mastermix Kit, New England Biolabs). 2 ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Physiology 2021Quote: ... RNA (0.5-1 μg) was reverse-trancribed to cDNA using LunaScript RT SuperMix Kit (New England Biolabs, Ipswich, MA, USA). TaqMan gene expression assays with FAM-labeled probes were purchased from ThermoFisher Scientific (Carlsbad ...
-
bioRxiv - Microbiology 2020Quote: ... separate reactions were performed for the quantification of SARS-CoV-2 N and E gene transcripts as well as cellular RNaseP for normalization using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) on a Bio-Rad CFX384 Touch system ...
-
bioRxiv - Genomics 2021Quote: All samples that met the previous criteria were submitted to cDNA synthesis protocol using LunaScript™ RT SuperMix Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Strand-specific CHIKV RNA primers were chosen from previous work [54] to amplify nucleotides 1-1560 of the CHIKV genome and used in reverse transcription reactions with the LunaScript8482 RT SuperMix Kit (NEB), followed by qPCR using the 2x qPCRBIO SyGreen Blue Mix (PCRBIOSYSTEMS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1-2 μg) was reverse-transcribed using LunaScript™ RT SuperMix Kit (New England Biolabs, Catalog No; E3010S). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Bioengineering 2022Quote: ... 500 ng of total RNA was used to synthesize cDNA using the LunaScript RT SuperMix Kit (New England Biolabs, E3010L). The Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...