Labshake search
Citations for New England Biolabs :
601 - 650 of 10000+ citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... equivalent quantities of total RNA were used for cDNA synthesis with the LunaScript RT SuperMix Kit (New England Biolabs). For RT-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Two step qPCR was carried out firstly by converting RNA into cDNA following the manufacturer’s instruction for LunaScript RT SuperMix Kit (New England BioLabs). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was generated from 500ng of RNA using the LunaScript RT Supermix kit (New England Biolabs, Cat. No. E3010L) according to the manufacturer’s directions ...
-
bioRxiv - Genomics 2020Quote: ... centered on the candidate miR-122 ORF site was cloned with NEB HiFi DNA Assembly Master Mix (New England Biolabs) into the open reading frame of firefly luciferase in pmirGLO ...
-
bioRxiv - Plant Biology 2020Quote: ... ChIP DNA was purified with the Monarch PCR & DNA Cleanup Kit (NEB). Libraries were prepared using ThruPLEX DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Cell Biology 2019Quote: ... then purified with Monarch PCR & DNA Purification Kit (New England BioLabs, T1030S) followed by T4 DNA Ligase reaction (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Digested DNA was purified with the Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... or the Monarch PCR and DNA Cleanup Kit (New England Biolabs, US). After Sanger-sequencing (Eurofins ...
-
bioRxiv - Biochemistry 2019Quote: All PCR reactions were performed using a Q5 DNA polymerase kit (NEB) and manufacturer recommended concentrations of primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then cleaned up using the Monarch PCR Cleanup kit (T1030L, NEB). Digested PCR products were then ligated to the digested pcs2+MCS-P2A-sfGFP plasmid using T4 DNA ligase (M0202S ...
-
bioRxiv - Genomics 2022Quote: ... PCR products were purified by gel extraction (Monarch gel extraction kit, NEB), and assembled into the backbones using NEB HiFi DNA Assembly master mix kit ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were purified by gel extraction (Monarch gel extraction kit, NEB), and assembled in a Golden Gate assembly containing 6.25 ng pU6-atgRNA-GG-acceptor (Addgene #132777) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... or cloned using the NEB® PCR cloning kit (New Englands BioLabs) to obtain haplotype resolution ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using the Monarch DNA Gel Extraction Kit (NEB) and eluted in 20 µl ddH2O ...
-
bioRxiv - Genetics 2020Quote: ... Amplicons were purified using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions and sent for 250 bp paired end Illumina amplicon sequencing (Genewiz) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Decrosslinked DNA was recovered using the Monarch PCR DNA Cleanup Kit (NEB), eluted in 50 µl of elution buffer and analysed by qPCR using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR reaction products were purified with Monarch DNA Clean-up Kits (NEB) with a binding buffer:sample ratio of 2:1 to remove products smaller than 2kb ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR templates for the dsRNA were prepared using T7 Megascript Kit (NEB). S2R+ cells were seeded at the density of 106 cells/ml in serum-free medium and 15 µg/ml of dsRNA was added to the cells ...
-
bioRxiv - Microbiology 2020Quote: ... Fragments were purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) after digestion or amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were transcribed with T7 HiScribe kit (New England Biolabs) and transfected together with TrueCas9 protein v2 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using Monarch PCR/DNA Cleanup Kit (New England BioLabs). ChIP-seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Genetics 2023Quote: ... Small RNA libraries were purified with the Monarch PCR Cleanup Kit (NEB) prior to size selection to obtain the correct fragment sizes for small RNA analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... each with 12-cycles (Phusion High Fidelity PCR kit, New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... The inactivated reactions were purified with the Monarch PCR purification kit (NEB).
-
bioRxiv - Synthetic Biology 2024Quote: ... and purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs). Gel fragments were extracted using GeneJet Gel extraction kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA reactions were purified using the Monarch PCR Purification Kit (NEB #T1030L) and eluted in 10µl elution buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... products were purified with the Monarch PCR DNA cleanup kit (NEB, Inc.) and analyzed by endpoint PCR ...
-
bioRxiv - Microbiology 2023Quote: ... purification (Monarch PCR & DNA Cleanup Kit, New England Biolabs Cat. No. T1030), and ligation with T4 DNA ligase (New England Biolabs Cat ...
-
bioRxiv - Microbiology 2023Quote: ... The enzyme was removed with the Monarch PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... PCR and Gibson Assembly® Cloning Kit (New England Biolabs, Ipswich, MA). The product was transformed in E ...
-
bioRxiv - Developmental Biology 2024Quote: ... IVT sgRNA products were purified Monarch PCR and DNA Cleanup Kit (NEB) and quantified ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using the Q5 High-Fidelity DNA Polymerase Kit (NEB) and primers specific for the microsatellite expansion adapters (1X Q5 Reaction Buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Beads were reinjected at 75 μl/h and co-flowed with 150 μl/h RT mix (1.65x Maxima H-RT Buffer, 0.033 U/μl USER II (NEB), 15 U/μl Maxima H-RT (ThermoFisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... The RT-RPA was performed at 42°C for 30 min by combining M-MuLV-RT (NEB #M0253L) with TwistAmp Basic (TwistDx #TABAS03KIT) ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized using MaximaH RT (NEB) enzyme following manufacturer’s protocol and oligoDT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Biochemistry 2022Quote: ... UPF2L (120-1227) were produced by PCR amplification (primers listed in Supplementary Table S1) using the Phusion High-Fidelity PCR kit (NEB #E0553S) prior to restriction digest and ligation into pPROEX-HTB (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... The remaining DNA was used to amplify fragments of the target site by PCR and amplicons were purified using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions and either sent for 250 bp paired end Illumina amplicon sequencing (Genewiz) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Fusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Molecular Biology 2022Quote: ... Two to three PCR reactions per sample were combined and cleaned-up using the Monarch PCR and DNA clean-up kit (NEB, T1030S). 10-100 ng of DNA from each sample was carried forward for end-repair using the NEBNext Ultra II End repair/dA-tailing Module (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear plasmid fragments were generated by PCR and purified by Monarch® PCR and DNA cleanup kit (New England BioLabs®). Ligations were performed with In-Fusion® enzyme at 50°C for 15 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Custom Nextera PCR primer and the NEBNext High-Fidelity 2x PCR Master Mix (Nextera DNA Library Preparation Kit (New England BioLabs, E7530L) and purified with the Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmid (Monarch® PCR mini-prep kit) and gel extraction kits (Monarch® DNA gel extraction kit) were also obtained from NEB and used according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative PCR was run on the Eppendorf Mastercycler (SybrGreen) using the LUNA Universal qPCR Master Mix (New England Biolabs, Catalog # M3003). Primers used for real-time qPCR can be found in Supplementary Data 5.
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).