Labshake search
Citations for New England Biolabs :
7051 - 7100 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The sequences were cloned into the pUASz1.0 vector (54) with the eGFP ORF at the C-terminal end of the Top3β ORF using a ligation kit (NEB). The UASz vector allows one to induce the constructs in any tissue ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR product was purified by phenol chloroform extraction and RNA was synthesized using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). 1 ug of starting linear DNA template was used and transcription was performed for 2hrs at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR-amplified DNA templates encoding 5’UTR of ATF4 mRNA were used for in vitro transcription of ATF4 reporter mRNA using HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... site-directed mutagenesis of the codon encoding lysine at amino acid position 41 was altered to alanine using the Q5 site-directed mutagenesis kit (New England Biolabs) using pPM11 as a template ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3xFLAG- and HA-tagged ZNRF3 expression vectors were generated with the Q5 Hot Start High-Fidelity DNA Polymerase Kit (New England Biolabs) by replacing the FLAG-tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and inserted into BamHI-HindIII-digested p413-PGPD vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, E5520S).
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Cancer Biology 2024Quote: ... and a final concentration determination was performed using NEBNext® Library Quant Kit for Illumina (New England Biolabs Cat. E7630) prior to library sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... or (Q71L for Arf1) and dominant negative (T27N for Arf6) or (T31N for Arf1) by using site-directed mutagenesis (SDM kit from NEB) kit ...
-
bioRxiv - Cell Biology 2024Quote: ... Poly(A) RNA libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs, #E7770) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) using 200-600ng total RNA as input ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared on beads using the Next Ultra II DNA Library Prep Kit for Illumina and Next Multiplex Oligos for Illumina (New England Biolabs) following instructions from the Arima-HiC+ for HiC (Arima Genomics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10ng of purified DNA (average size 250–300bp) was used to prepare sequencing libraries with the Next Ultra II Library Prep Kit for Illumina (New England Biolabs) using the application note for “Low input ChIP-seq” ...
-
bioRxiv - Molecular Biology 2023Quote: ... Resulting footprints were then used to generate sequencing libraries using the NEBNext Small RNA Library Prep Set for Illumina kit (New England BioLabs). Library quality was assessed using High Sensitivity DNA Chips with the Agilent 2100 Bioanalyzer System (Agilent Technologies).
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were run on a 1% agarose gel and DNA was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs). DNA was sequenced by Sanger sequencing using either the forward or reverse primer ...
-
bioRxiv - Immunology 2023Quote: ... Live CD19+ B cells and CD4+PD1+CXCR5- Tph cells were purified by high-speed sorting (FACSAria II) and were directly processed using NEBNext Single Cell/Low Input RNA Library Prep Kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... mutations were created in the chromoshadow domain of HP1γ in pGEMT-KpnI-HP1γ using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions (Data S1) ...
-
bioRxiv - Systems Biology 2023Quote: ... and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), using 700ng of RNA per sample ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning was performed by assembling the purified PCR fragments into the specified pET derivative expression vector using the commercially available NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Genomics 2023Quote: ... 170-200 ng of library was indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The manufacturer’s protocol was followed with the following deviations ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA from single adult male flies was extracted using using the Monarch Genomic DNA Purification Kit (New England Biolabs), using a protocol we developed (dx.doi.org/10.17504/protocols.io.bp2l694qklqe/ v1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 500ng of total RNA were used for RNA-Seq library preparation with the NEBNext Ultra II RNA Library Prep Illumina Kit (NEB) and sequenced with the NextSeq 500/550 sequencing platform (performed at the NYUAD Sequencing Center within the NYUAD Core Technology Platform) ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were then generated using 10 ng of DNA and NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the C-terminus of the Apoptin encoding plasmid was removed and replaced with the Mxe-GyraseA Intein using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). Sanger sequencing of resulting plasmids was carried out by GENEWIZ.
-
bioRxiv - Molecular Biology 2023Quote: RNA-seq libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing libraries were quantified by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... pLENTI-CMV-GPRC5A was mutated to remove m6A sites (A57G, G120T, C174T, A264G) using Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were inserted into pMQ123 downstream of the Ptac promoter using the NEBuilder HiFi DNA Assembly kit (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2023Quote: Reporter fusions of sRNA targets were in-vitro translated in the absence and presence of sRNA using the PURExpressⓇ In Vitro Protein Synthesis kit (NEB). Four picomoles of in-vitro transcribed 5’UTR reporters (including the RBS/sRNA interaction site and the first 10 codons of flgM ...
-
bioRxiv - Cancer Biology 2022Quote: ... the fragments were purified and used for adapter ligation and library amplification using the NEBNext Ultra II Fs DNA Library kit for Illumina (NEB # E7805, New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: RNA-Seq Libraries were generated using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB). The RNA-Seq libraries were quantified by Qubit and qPCR according to the Illumina Sequencing Library qPCR Quantification Guide and the quality of the libraries was evaluated on Agilent Bioanalyzer 2100 using the Agilent DNA-1000 chip ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA-sequencing libraries were prepared from 500 ng total RNA using the Ultra II directional RNA library preparation kit (NEB) in combination with the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2023Quote: ... GPRC5A-FLAG and GPRC5A expressing plasmids were generated by PCR of the entire coding sequence of GPRC5A from TREx BCBL1-Rta cDNA and cloning using NEBuilder HIFI DNA assembly kit (NEB) into pLENTI-CMV-GFP-PURO ...
-
bioRxiv - Neuroscience 2023Quote: ... and cDNA was prepared with Protoscript II first-strand cDNA synthesis kit as per manufacturer’s protocol (New England Biolabs, USA). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a knockout construct was assembled into the suicide plasmid vector pZDJ 78 with either the Gibson Assembly Cloning Kit or the NEBuilder HiFi DNA Assembly Master Mix (both New England Biolabs). The antibiotic resistance cassette flanked by flippase recognition target (FRT ...
-
bioRxiv - Genomics 2022Quote: ... DNA was ultrasonicated to a fragment size of 270 bp and the library was prepared using an Ultra DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the eluted DNA was used to make sequencing libraries using the NEBNext Ultra or Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers with 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteinase K was inactivated (20 min 82 °C) and the crRNA target site was amplified with One Taq Hot Start DNA polymerase kit (NEB), followed by Sanger sequencing (primers in Table S3) ...
-
bioRxiv - Cell Biology 2023Quote: ... Library quality was confirmed using an Agilent BioAnalyzer 2100 and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). Sequencing was performed using the Illumina NextSeq500 platform employing a single-end ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and p.2.5’ genomic RNA was generated by in vitro transcription using the HiScribe™T7 ARCA mRNA kit (New England Biolabs). For ZIKV-WT ...
-
bioRxiv - Cell Biology 2023Quote: ... and library prep performed on the beads using the NEBNext Ultra II DNA library prep kit for Illumina (NEB, E7645L), according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...