Labshake search
Citations for New England Biolabs :
651 - 700 of 4951 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 U of Antarctic phosphatase (NEB M0289S) then incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μl of quick ligase (NEB M2200L). To release the non-ligated strand of the adaptor ...
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 μl 5× Q5 Polymerase Buffer (NEB #M0491), 0.25 μl Q5 DNA Polymerase (NEB #M0491 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Excess adapters were digested using 5’-Deadenylase (NEB) and RecJf (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... the 5-µl of Bst 2.0 (NEB, M0537S) enzyme mixture (1× isothermal buffer ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5′ cap repair with RppH (NEB) and 5′ hydroxyl repair with PNK (NEB) ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... and 5 U/μL Taq DNA polymerase (NEB) for incubation at 25°C for 60 min and heating at 68°C for 30 s and then at 75°C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: Purified GST-Bbs5 protein (400 μg) was incubated with 6 μl of PKC (New England Biolabs) and 10 μl of ATP (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Two-hundred nanograms of total RNAs were reverse-transcribed using Random primer 6 (New England Biolabs) and Superscript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... we introduced a 6-bp mutation using the Q5 site-directed mutagenesis kit (New England Biolabs). The pUAST-attB constructs were inserted into either attP40 or attP86Fb (for Piezo constructs ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Microbiology 2020Quote: ... and performed 6–9 cycles of PCR with the NEBNext Ultra II Q5 Master Mix (NEB) using Illumina P7 and the Seq-Well P5-TSO hybrid primer (Gierahn et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... Polylinker libraries were amplified using primers BC_CRX_Nested_F and BC_CRX_R (Supplementary file 6) for 30 cycles (NEB Q5) at an annealing temperature of 67C and then purified with the Monarch PCR kit ...
-
bioRxiv - Systems Biology 2019Quote: ... Biotinylation was performed in a 90 µl reaction with 6 U of T4 ssRNA Ligase (NEB), 4 µl Biotinylated Cytidine (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted dsRNA was mixed with Gel Loading Dye Purple (6×) (New England Biolabs, cat. #B7024S) and separated by 10% polyacrylamide gel (25 mA at 4°C for 18 hours) ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Genomics 2024Quote: ... the cfDNA can be de-phosphorylated by adding 6 μl of Antarctic Phosphatase buffer 10x (NEB), 2 μl of Antarctic Phosphatase Enzyme (NEB) ...
-
bioRxiv - Biophysics 2019Quote: ... The resulting product (typically 50 – 100 μL of 5 – 20 μM of protein) was mixed with an equimolar amount of SNAP-Surface 549 (New England Biolabs; 1 mM in DMSO) and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Genomics 2019Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...