Labshake search
Citations for New England Biolabs :
6851 - 6900 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were dual-indexed (NEBNext Dual Index Primers Set 1, NEB E7600S), and sequenced on an Illumina NextSeq 2000 instrument with P3 300 cycle reagents ...
-
bioRxiv - Genomics 2022Quote: ... two adaptor ligations using T4 RNA Ligase 1 (catalog no. M0204; NEB) and reverse transcription using SuperScript III Reverse Transcriptase (catalog no ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with Murine RNAse inhibitor (1 U/μL, “RI”, New England Biolabs) and ribonucleoside vanadyl complex (RVC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and an additional 1 mM of Q5 enhancer (New England Biolabs Inc.) for trnLUAA-trnFGAA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 U/μL of rSAP enzyme (New England BioLabs, Product no.: M0371S), and water in 10 μL reaction scale ...
-
bioRxiv - Genomics 2022Quote: ... the 1:99 target:background sample was digested with FspEI (New England Biolabs) according to the manufacturers protocol (incubation at 37°C for 90 minute ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 µL of MNase (stock at 25 U/µL) (New England Biolabs) and 63 µl of water ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Microbiology 2022Quote: ... 150 µl Proteinase K (800 units ml-1; New England Biolabs #P8107S), 138 µl 20% SDS ...
-
bioRxiv - Microbiology 2023Quote: ... with NEBnext Multiplex Oligos for Illumina (Primer Set 1) (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... prior to incubation with 1% SDS and proteinase K (20mg/mL, NEB) to inactivate and degrade pA-Tn5 ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg RNA was converted into cDNA using ProtoScript II RT (NEB), oligo(dT)s and Murine RNAse inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (NEB, Cat.R0155M) and RsaI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were resuspended in 1 X DNAse buffer (New England Biolabs) and then treated with DNAse (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ug of DNA was incubated with 6U RNAse H (NEB, M0297) at 37 °C for 2 h ...
-
bioRxiv - Genomics 2023Quote: 1 µg of each library in pDONR223 was digested with Blp1 (NEB) for 1 h 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 ug of RNA was reverse transcribed using the Lunascript Supermix (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reaction samples were loaded onto 1 ml of amylose resin (NEB). Proteins in the flow-through fractions were further purified by gel filtration chromatography (Superdex 200pg ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin was washed once by 1× T4 DNA ligase buffer (NEB, B0202) and pelleted by centrifugation.
-
bioRxiv - Cell Biology 2024Quote: ... Transfected cells were labeled with 1 µM SNAP-Surface 674 dye (NEB) for 30min followed by washing two times for 10 min with 300 µl MES300 per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.3% Tween 20) with 1 μL proteinase K (800 U/ml, NEB) in 96 well plates ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 1 mL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were treated with 1 μl of RNase-free DNase (NEB) to 100 μl of RNA solution and cleaned up with a Monarch RNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Biophysics 2023Quote: ... The lysates were clarified and loaded on 1 mL chitin resin (NEB) and washed with 1 M KCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of genomic DNA was digested with EcoRI-HF enzyme (NEB) and analyzed using the QX100 system (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (R0155M; NEB) and RsaI (R0167L ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... MNase digestion was performed by addition of 1 μL MNase (NEB, M0247S) at 37 ℃ for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of template plasmid was digested using 1µL AgeI (NEB, R3552S) for 15h in Cutsmart Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µL of Template Switching RT Enzyme Mix (NEB Catalog# M0466L). After mixing ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... endoglycosidase H (500 units, 1 μl, New England Biolabs, catalog no. P0702) was added to each of the SLNYLLYVSN peptide samples ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng genomic DNA was digested with HaeIII (New England Biolabs, R0108L). TBP served as the internal control ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 μL Antarctic Thermolabile UDG (1 U/μL; New England Biolabs, M0372S), 5.4 μL Bst2.0 DNA Polymerase (120 U/μL ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: SQBs (1 µg) were incubated with 1.0 U/µL DNase I (NEB) with 10 × DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...