Labshake search
Citations for New England Biolabs :
601 - 650 of 1470 citations for Recombinant Human CD40 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biophysics 2019Quote: ... uncleaved fractions and 3C protease were removed by Ni-chelated sepharose and the G protein was dephosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: 750000 cells were harvested and resuspended in 40 μL lambda protein phosphatase reaction buffer (1X NEBuffer Pack for Protein MetalloPhosphatases (NEB), 1mM MnCl2 (NEB) ...
-
bioRxiv - Plant Biology 2021Quote: The MBP-NbERF-IX-33a fusion protein was prepared using the pMAL Protein Fusion and Purification System (New England Biolabs). E ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Plant Biology 2024Quote: ... An aliquot containing 10 mg of protein was then subjected to lambda protein phosphatase reaction mix following the manufacturer’s instructions (New England Biolabs, US) for 1 hour at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μL of magnetic beads protein A (NEB) were added to the mixture and incubated for 4 h at 4°C on a rotating wheel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs, 1620115). Membranes were then incubated with primary antibody diluted in 5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... we injected Cas9 mRNA or protein (NEB, M0646T) with corresponding sgRNAs into 1-cell wild-type Tuebingen embryos ...
-
bioRxiv - Developmental Biology 2021Quote: Protein extraction was performed with RIPA buffer (NEB) in the presence of protease and phosphatase inhibitors (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins with or without PNGase F (NEB, USA) digestion were mixed with the loading buffer (250Mm Tris-HCl PH 6.8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 90 nM of SpCas9 protein (New England Biolabs), Cas9 nuclease buffer (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PNGase F (P0704, NEB, 1,000 units/µg protein) was used to remove the N-linked glycosylation in purified ORF8 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were treated with Lambda Protein Phosphatase (NEB) for 30 min at 30 °C followed with an additional four times washing step before they were blocked ...
-
bioRxiv - Microbiology 2020Quote: ... and proteins were purified with amylose resin (NEB) and eluted with 20 and 50 mM maltose (Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... All proteins were purified using Amylose Resin (NEB) or HisPur Cobalt Resin (Thermo ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10µl of Protein G magnetic beads (NEB, S1430S) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1μl of T4 bacteriophage protein (NEB, 5ng/μl), 3μl of DMSO ...
-
bioRxiv - Molecular Biology 2019Quote: ... The protein was purified using amylose resin (NEB) using the provided protocol ...
-
bioRxiv - Pathology 2020Quote: ... plasma and histone H3 protein (New England Biolabs) as standard were subjected to SDS-PAGE and electrically transferred onto PVDF membrane (Millipore) ...
-
bioRxiv - Biophysics 2020Quote: ... Eluted protein was deglycosylated with PNGase F (NEB) by incubating 5 units of the enzyme per 1 μg of protein for 2 h at 37 °C under gentle agitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gRNAs were mixed with protein Cas9 (NEB), allowed 5 minutes at 37°C to assemble into ribonucleoprotein complexes ...
-
bioRxiv - Microbiology 2019Quote: ... Lactis Protein Expression kit (New England Biolabs, UK) was used with the pKLAC2 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μL Protein G magnetic beads (NEB, S1430S) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... The gRNA and Cas9 protein (New England Biolabs) were injected into one-cell stage NHGRI-1 embryos in a 2 nl volume consisting of ∼50 ng/μl gRNA and ∼300 nM Cas9 ...
-
bioRxiv - Cell Biology 2022Quote: ... were added to 1x protein kinase buffer (NEB) supplemented with 200 μM “cold” ATP (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complexes of SpCas9 protein (NEB; Ipswitch, MA), ssODN template and gRNA were prepared with final concentration 200 μg/μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Broad Range Protein Marker (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (New England BioLabs inc.). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Cell Biology 2023Quote: ... and PMP with Lambda Protein Phosphatase (P0753S, NEB) with Phosphatase inhibitor cocktail (4X ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were purified by Amylose resin (NEB) and eluted with 10 mM maltose ...
-
bioRxiv - Biophysics 2023Quote: ... and phosphorylated with protein kinase A (PKA) (NEB) for 1 hour at 20 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...
-
bioRxiv - Biochemistry 2024Quote: ... 30nM sgRNA and 30 nM Cas9 protein (NEB) for 1h at room temperature and analyzing cleavage products on a 2% agarose gel ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL of λ protein phosphatase (NEB P0753S) was added and incubated at 37°C for 30 minutes and then placed on ice ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (PURExpress, New England Biolabs). Reactions were performed according to manufacturer’s instruction and as previously described in 82 with a few modifications ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP and Halo fusion proteins were labeled with JF549 or JF646 dyes (HHMI Janelia Research Campus) (Grimm et al., 2015) or SNAP-Cell Oregon Green® (NEB, S9104S).
-
bioRxiv - Cell Biology 2022Quote: ... The kinesin and GBP constructs were exchanged into 1x PBS with 1 mM DTT and labeled with DNA and SNAP-Surface Alexa Fluor 647 (NEB, Ipswich, MA) dye directly after elution ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcribed RNAs were treated with Antarctic phosphatase (Fermentas, Waltham, MA) to remove the 5’ terminal phosphate and then labeled by T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA) in the presence of γ-32P-labeled ATP (PerkinElmer ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...