Labshake search
Citations for New England Biolabs :
801 - 850 of 1570 citations for Recombinant Human CD40 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Eluted protein samples flowed through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Neuroscience 2020Quote: ... Ca2+/calmodulin-dependent protein kinase II (CaMKII, New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Blue Protein Standard Broad Range (New England Biolabs, Hitchin, UK) was used as a protein marker ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified GST-fusion proteins were incubated with CK2 enzyme (NEB) in 20μl kinase buffer (20mM Tris-HCI [pH 7.5] ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x NEB-uffer for Protein Kinases (New England Biolabs). The samples were then subjected to protein precipitation ...
-
bioRxiv - Biochemistry 2021Quote: 10 ug of protein extract were digested with PNGaseF (NEB) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1X protease inhibitor cocktail ± lambda protein phosphatase (New England Biolabs) as per the manufacturer’s instructions and incubated at 30°C for one hour.
-
bioRxiv - Cell Biology 2022Quote: ... samples were treated with Lambda Protein Phosphatase (New England BioLabs). We found that for efficient dephosphorylation of CSF extract samples ...
-
bioRxiv - Microbiology 2022Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Cas9nls protein was obtained from NEB (cat number M0646T).
-
bioRxiv - Synthetic Biology 2022Quote: We used PURExpress In Vitro Protein Synthesis Kit (NEB, E6800L) and the reaction was set up with the following manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... 100 ng of T4 gene 32 protein (New England Biolabs), and 3× PrimeScript enzyme mix (Cat# RR037A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Synthetic Biology 2020Quote: We analyzed protein digests of purified ribosome (New England BioLabs) and purified LacZ (FUJIFILM Wako Pure Chemical Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Blue pre-stained protein standard (11-190kDa) (New England Biolabs) was used ...
-
bioRxiv - Genomics 2020Quote: ... The APOBEC3A protein was produced by (NEB E7133, Ipswich, MA).
-
bioRxiv - Biophysics 2020Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Microbiology 2021Quote: ... and Nico (λDE3) with reduced histidine-rich background proteins (NEB). The RNase I precursor contains a signal peptide (amino acid residues 1-23 ...
-
bioRxiv - Immunology 2021Quote: ... These two proteins were also treated with PNGase-F (NEB) under the reduced condition to remove N-glycans and loaded on the gel to assess the impact of the glycans on the protein size ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein A magnetic beads (New England Biolabs, Ipswich, MA, USA) were then added to the cell lysate and antibody mixture ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μL of lambda protein phosphatase (NEB, Catalog #P0753S) were added to the washed FRQ-coupled V5 resin ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used to translate the synthetic transcriptome described above ...
-
bioRxiv - Microbiology 2022Quote: ... A pre-stained protein standard (New England Biolabs, MA, USA) was used to estimate molecular weight ...
-
bioRxiv - Cell Biology 2024Quote: ... STAT1 proteins were dephosphorylated by lambda phosphatase (NEB, Ipswich MA) followed by the addition of protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were expressed in BL21(DE3) (New England Biolabs) in LB grown in 2 L baffled shake flasks ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were removed using the Monarch RNA Cleanup Kit (NEB) and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and Lambda Protein Phosphatase (Lambda PP) was purchased from NEB. After kinase reaction in kinase buffer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The unbound fraction was dephosphorylated using lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 µl of prestained protein ladder (New England Biolabs). The gel was electrophoresed at 150 V ...
-
bioRxiv - Cell Biology 2023Quote: ... in the presence of protein kinase buffer (New England Biolabs) with 3 μCi [γ-32P]ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... kit and co-injected with Cas9 protein (New England Biolabs) into one-cell stage zebrafish eggs ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Microbiology 2024Quote: Experiments with PURExpress In Vitro Protein Synthesis Kit (NEB, E6800) were performed as per the manufacturer’s instructions using 10 ng/µL of DHFR-Strep reporter plasmid with the addition of 0.8 U/µL RNase Inhibitor Murine (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... The mix consisted of 1 µL Cas9 protein (BioLabs, M0369M), 1 µL Fast Green FCF dye (Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... 400 U Lambda Protein Phosphatase (New England Biolabs, Frankfurt, Germany) in NEBuffer ...
-
bioRxiv - Microbiology 2024Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Human α-synuclein cDNA from a pcDNA3.1 plasmid was restriction digested with EcoRI and HindIII (NEB), purified and ligated in the same sites of the pAAV2.5-THP backbone to generate the pAAV2.5-TH-α-syn plasmid ...
-
bioRxiv - Biophysics 2022Quote: ... The human μOR and V2R were amplified with a SNAP tag at their N-terminal (NEB) and subcloned in the pcDNA4/TO plasmid (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Neuroscience 2022Quote: ... made from pCX with the promoter replaced by human Synapsin (hSyn) using golden gate assembly (NEB). For synaptic labelling pCAG-GPHN-FingR-EGFP-CCR5TC40 Addgene # 46296 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext rRNA Depletion Kit v2 (Human/ mouse) (NEB #E7405), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...