Labshake search
Citations for New England Biolabs :
601 - 650 of 8771 citations for Mouse Activation Induced Cytidine Deaminase AICDA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... using the NEBuilder Gibson assembly kit (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: The Q5 Site-Directed Mutagenesis kit (New England Biolabs) was used to introduce mutations into the mtHsp60 expression construct.
-
bioRxiv - Biophysics 2023Quote: ... The Q5 site-directed mutagenesis kit (New England Biolabs) was used for preparation of mutants.
-
bioRxiv - Cell Biology 2023Quote: ... The Q5 Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate pUASPattb-GFP-Shot ABDY364F ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was purified using a PCR purification kit (NEB) following manufacturer instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... adaptors ligation with Quick Ligation kit (NEB, cat. M2200) and amplification with Phusion Flash HF PCR master mix (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... using the Monarch DNA gel extraction kit (NEB #T020S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Amplicons were purified with the Monarch PCR kit (NEB), digested with MfeI-HF and SphI-HF (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Quick Ligase kit (M2200, NEB, Ipswich, US). For a site-directed mutagenesis the central guanine of the seed sequence was exchanged for an adenosine ...
-
bioRxiv - Microbiology 2023Quote: ... and NEB Ultra II RNA library prep kit (NEB) were used to prepare complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... the NEBNext Ultra II DNA Library Prep Kit (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cloning was done using a Gibson Assembly kit (NEB) and NEB5a competent cells (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... products were purified using an RNA purification kit (NEB), absorption at 260 nm was determined and length of the RNA product was analyzed on a 1 % agarose gel.
-
bioRxiv - Molecular Biology 2023Quote: ... then cloned into pCW57.1 using HiFi assembly kit (NEB). All the plasmids were sequenced and verified ...
-
bioRxiv - Molecular Biology 2023Quote: ... after rRNA depletion (NEBNext rRNA depletion kit by NEB) using 1 μg of total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... a Q5® Site-Directed Mutagenesis Kit (NEB #E0552S) was used ...
-
bioRxiv - Molecular Biology 2023Quote: The Q5 High-Fidelity Polymerase kit (Cat# M0493, NEB) was used for amplification (5 μL 5× Q5 reaction buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Biochemistry 2024Quote: ... and purified with Monarch PCR & DNA cleanup kit (NEB). PURExpress in vitro translation reaction was assembled in RNase-free tubes according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... and ligated using Quick Ligase Kit (New England BioLabs) according to manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... and assembled using Gibson Assembly Cloning Kit (NEB, E5510S) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The details of plasmids source and usage are listed in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purification with a PCR clean-up kit (NEB) following the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were purified with a PCR purification kit (NEB). Approximately 120–150 ng of DNA was used as a template for a T7 in vitro transcription (IVT ...
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using the Monarch RNA Cleanup Kit (NEB) and stored at −80 °C before use ...
-
bioRxiv - Bioengineering 2024Quote: LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA using primers oAS344 for cRNA and oAS345 for vRNA (Supplementary Note 21).
-
bioRxiv - Microbiology 2024Quote: ... gel purified with Monarch DNA Gel Extraction Kit (NEB), and ligated with T4 DNA ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and library quantification using NEBNext Library Quant kit (NEB), the sequencing was performed under the setting of single read 1×51 bp to generate ∼30 million reads per sample on HiSeq 1000 sequencer (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... a site-directed mutagenesis kit (New England Biolabs Q5) was used ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...