Labshake search
Citations for New England Biolabs :
651 - 700 of 9441 citations for Mouse Activation Induced Cytidine Deaminase AICDA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... then cloned into pCW57.1 using HiFi assembly kit (NEB). All the plasmids were sequenced and verified ...
-
bioRxiv - Molecular Biology 2023Quote: ... after rRNA depletion (NEBNext rRNA depletion kit by NEB) using 1 μg of total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... a Q5® Site-Directed Mutagenesis Kit (NEB #E0552S) was used ...
-
bioRxiv - Molecular Biology 2023Quote: The Q5 High-Fidelity Polymerase kit (Cat# M0493, NEB) was used for amplification (5 μL 5× Q5 reaction buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were constructed using Ultra II DNA kit (NEB).
-
bioRxiv - Biochemistry 2024Quote: ... and purified with Monarch PCR & DNA cleanup kit (NEB). PURExpress in vitro translation reaction was assembled in RNase-free tubes according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... the Monarch Genomic DNA Purification kit (New England Biolabs) was utilized with 1-2 x 106 cells ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... we used Q5 site-directed mutagenesis kit (NEB# E0554S). Primers were designed according to the sites to be scrambled as shown in the table below ...
-
bioRxiv - Microbiology 2024Quote: ... spin purified with DNA clean and concentrate kit (NEB), and sequenced with Plasmidsaurus.
-
bioRxiv - Microbiology 2024Quote: ... the NEBNext Ultra II DNA Library Prep Kit (NEB) was used according to the manufactu er’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... using Qubit DNA HS kit (New England Biolabs, M0494S). The final RP libraries were single-end sequenced with a NextSeq2000 P2 system (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Quick Ligase kit (M2200, NEB, Ipswich, US). For a site-directed mutagenesis the central guanine of the seed sequence was exchanged for an adenosine ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ligation (T4 DNA Ligase Kit, M0202, NEB) of the resulting products at a 1:3 molar ratio of vector to insert ...
-
bioRxiv - Cell Biology 2024Quote: ... or using NEB LunaScript RT SuperMix kit (NEB #E3010L). In both cases ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using Monarch RNA Cleanup Kit (NEB, T2030S). 100 ng mRNA was aliquoted and stored as input at –80°C ...
-
bioRxiv - Biochemistry 2024Quote: A Q5 Site-directed Mutagenesis Kit (New England Biolabs) was used per the manufacturer’s instructions with the primers in Table S1 and a pET15b-holC plasmid to mutate arginine 128 to alanine in the HolC protein ...
-
bioRxiv - Bioengineering 2024Quote: ... and Ultra II Directional RNA Library Prep Kit (NEB) to isolate mRNA and perform dUTP directional preparation of the mRNA library ...
-
bioRxiv - Bioengineering 2024Quote: ... Ligations were done with the Quick LigationTM Kit (NEB). NEB® Stable Competent E ...
-
bioRxiv - Bioengineering 2024Quote: ... purified using the Monarch DNA Gel Extraction Kit (NEB), confirmed via Sanger sequencing (Genewiz) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and subsequently purified (Monarch® RNA Cleanup Kit, NEB). All tailed and untailed mRNA samples were normalized to a concentration of 50ng/µl and quality was assessed via TapeStation RNA ScreenTape Analysis (Agilent ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Monarch® RNA Cleanup Kit (New England Biolabs) was used to purify transcribed RNA strands ...
-
bioRxiv - Molecular Biology 2024Quote: The Q5 Site-Directed Mutagenesis Kit (New England Biolabs) was used to introduce the mutations into pET15b plasmid-borne copies of PRX1 and TRX3 genes using pairs of adequate ...
-
bioRxiv - Microbiology 2024Quote: ... purified using the Monarch DNA Gel Extraction kit (NEB) and ligated using T4 DNA ligase (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... HiFi DNA assembly cloning kit (New England Biolabs (NEB)) was used according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... or HiScribe T7 ARCA mRNA Kit (New England Biolabs), evaluated spectrophotometrically and by gel electrophoresis ...
-
bioRxiv - Neuroscience 2024Quote: ... or Q5 Site-Directed Mutagenesis Kit (New England Biolabs). To improve PCR yield with the GCrich hα1B template ...
-
bioRxiv - Microbiology 2024Quote: ... HiFi DNA assembly cloning kit (New England Biolabs (NEB)) was used according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... a Quickchange site-directed mutagenesis kit (New England Biolabs) was used to introduce the F405L and K409R mutations in the HC plasmids of the IgGs to make the bsAbs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were prepared using the NEBNext Ultra II DNA Prep Kit following the published protocol for this kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we isolated DNA from tissue using the Qiagen DNeasy Blood and Tissue kit (Valencia, CA, USA) and created genomic libraries using the NEBNext Ultra II kit (New England BioLabs; Ipswich, MA, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... to evaluate the performance of our library preparation protocol – TM3’seq – and compare it to the performance of a commercial kit commonly used to generate RNA-seq libraries – NEBNext® Ultra™ Directional RNA kit (NEB, #E7420S). Three replicates of 200ng total RNA per tissue (blood and adipocyte ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was carried out using the Gibson Assembly® Master Mix kit and NEBuilder® HiFi DNA Assembly kit (New England Biolabs, US). Genomic DNA was prepared by the Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA harvested with the Masterpure Complete DNA/RNA Purification Kit was bisulfite treated using the EpiMark Bisulfite Conversion kit (NEB; Ipswich, MA, USA); both per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from total RNA using Ribo-Zero™ rRNA removal Kit and library was made using Illumina NEBNext® Ultra™ Directional RNA Library Prep Kit (E7420L, NEB). The libraries were loaded on an Illumina HiSeq X ten instrument (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Genetics 2024Quote: ... The fragmented samples were purified with Expin™ PCR SV kit (GeneAll) and prepared as an NGS library with NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB). The prepared samples were sequenced with MiniSeq High Output Reagent Kit (300-cycles ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Libraries for each sample were prepared using the NEBNext Ultra II DNA Library Prep Kit and NEBNext Muliplex Oligos for Illumina Kits (New England Biolabs, Ipswich, Massachusetts, USA) following the NEBNext Ultra II Version 5 protocol with size selection on DNA fragments at 300-400bp range ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...