Labshake search
Citations for New England Biolabs :
601 - 650 of 868 citations for 6 amino 7H benzo e perimidin 7 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was isolated from 50ng of total RNA (RIN value >7) using the NEBNext® Poly(A) mRNA magnetic isolation module, (New England BioLabs, Hitichin, Herts, UK) (NEB, #E7490) and the sequencing libraries were prepared using the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Cell Biology 2019Quote: ... One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs). Quantitative real time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Cell Biology 2022Quote: ... and were assembled into pHaloTag-C1 to produce the pHalo-Baf in one-step using the Gibson Assembly Master Mix (New England Biolabs). The cGAS cDNA was amplified by the KOD One from pLPC-cGAS-Flag (Dou et al. ...
-
bioRxiv - Genomics 2020Quote: ... One microgram of DNase-treated total RNA was reverse transcribed using AMV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and a gene-specific primer for either the germline-limited gene or actin II control ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Microbiology 2019Quote: ... samples were diluted to 5ng/uL and used for qRT-PCR with Luna One-Step Universal qPCR kit (NEB E3005). Gene specific primers for target transcripts were used at a final concentration of 400uM with 15ng of RNA ...
-
bioRxiv - Genomics 2019Quote: ... Ligated RNA was enriched with biotin-labeled products by another round of Streptavidin bead binding and washing (two washes each of High, Binding and Low salt buffers and one wash of 1x Thermo Pol Buffer (NEB)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). RNA was then subjected to fragmentation using RNA Fragmentation Reagents (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... was incubated with 2 μΜ biotinylated oligo complementary to one of the two 12 nt cohesive ends in λDNA in T4 DNA ligase reaction buffer (NEB) and hybridized at 70°C for 15 min followed by cooling to 15°C over 2 h ...
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... A HiFi assembly reaction was then performed to join the PCR product with the linear pEERM1 to form the assembled circular plasmid by incubating at 50 °C for one hour using NEBuilder DNA HiFi Assembly Master Mix (New England Biolabs). The HiFi reaction solution (5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Immunology 2020Quote: ... the first one obtained by digesting the pcDNAI-GAL4-CREB vector with EcoRI and XbaI restriction enzymes (New England Biolabs), and the second part obtained by amplifying either the extracellular or the intracellular coding regions of the MerTK vector by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Microbiology 2022Quote: The copy number of viral RNAs were titrated by qRT-PCR using Luna Universal Probe One-Step RT-qPCR Kit (NEB) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Genomics 2022Quote: Real-time PCR (RT-PCR) amplification of RNA was performed following the Luna Universal One-Step RT-qPCR kit (New England Biolabs). A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for up to one month until used for purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). Five larvae were pooled for each RNA purification and homogenized in DNA/RNA protection buffer with a glass homogenizer prior to proteinase K digestion ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining 50 μL was used as input for one round of end repair and adapter ligation with NEBNext Ultra II DNA Library Preparation kit (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... This plasmid was digested with XbaI and NheI enzymes to release TcZC3H12-HA sequence followed by the Neomycin expression cassette and treated with One Taq DNA polymerase (NEB) to allow for cloning in pCR2.1-TOPO plasmid (Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...