Labshake search
Citations for New England Biolabs :
6201 - 6250 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2019Quote: ... Libraries were constructed using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s instructions and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the libraries for Illumina whole-genome sequencing were prepared with NEBNext master mix kits (New England Biolabs), and the sequencing was done with Illumina HiSeq2000 (Mattila et al ...
-
bioRxiv - Developmental Biology 2019Quote: ... Guide RNAs were generated by PCR and transcribed using HiScribe T7 High-Yield RNA Synthesis Kit (NEB). 110-140 pg of guide RNA and 170 pg of cas9 mRNA per embryo was injected at one-cell stage into the cell ...
-
bioRxiv - Developmental Biology 2019Quote: ... F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB) using primers Gli3 F387Ffs* Fwd CCAACACAGAGGCCTATTCC and Gli3 F387Ffs* Rev AAAGTTGGGGCAGGGTGG following the manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR products with the expected size were column-purified with the Monarch PCR & DNA Cleanup Kit (NEB) and Sanger sequenced by GATC-Eurofins or Microsynth ...
-
bioRxiv - Genomics 2019Quote: DNA libraries were constructed using the NEBNext® Ultra™ II DNA Library Prep kit (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2019Quote: ... The RNA was synthesized in vitro using HiScribe T7 ARCA mRNA Kit (New England Biolabs, Ipswich, MA) or mMESSAGE mMACHINE T7 ULTRA Transcription Kit (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... The assay was performed using the PURExpress In Vitro Protein Synthesis Kit (E6800S New England Biolabs, Inc.), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed using the Phusion High-Fidelity PCR Kit (New England Biolabs Inc, Ipswich, UK) and the final reaction contained 250 ng of template DNA ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries were prepared using a NEBNext Ultra II DNA Library Prep Kit (New England Biolabs; E7103). ATAC-seq was conducted as described in (Buenrostro et al. ...
-
bioRxiv - Genetics 2021Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Genetics 2020Quote: ... corresponding to the point mutation in the SARS-CoV-2 genome (Q5 Site-directed mutagenesis kit, NEB). Site directed mutagenesis primers (Table S1 ...
-
bioRxiv - Genetics 2020Quote: The cDNA was generated by ProtoScript® II First Strand cDNA Synthesis Kit (New England BioLabs, #E6560L). qPCR was performed toward eol-1 ...
-
bioRxiv - Genomics 2021Quote: ... and the manufacturer’s instructions were followed as outlined in the kit manual (New England BioLabs, Inc., USA). The library was sequenced across two Illumina HiSeq 2500 lanes with 2×150 bp paired-end sequencing at the Brigham Young University DNA Sequencing Center (Provo ...
-
bioRxiv - Genomics 2021Quote: The EM-seq libraries were prepared using the NEBNext Ultra II DNA library prep kit (NEB E7645) (using the NEBNext EM-seq adapter) ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were prepared using NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA, USA). Sequencing was performed on the NextSeq500 platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid assembly was performed using Gibson assembly and the NEB HiFi assembly kit (NEB, New England, MA). The assembly mixture was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... Specific gRNA and KOD PCR were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) on the pSAG1::Cas9-U6::sgUPRT vector (42 ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) with 9 cycles PCR amplification ...
-
bioRxiv - Molecular Biology 2021Quote: Samples with CT <25 were submitted to cDNA synthesis protocol using LunaScript™ RT SuperMix Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: RNA-sequencing libraries were produced with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) from hiPSC-derived astrocytes of ST ...
-
bioRxiv - Genomics 2021Quote: ... In Vitro Transcription (IVT) was performed with T7 high yield RNA synthesis kit (New England Biolabs, E2040S). The RNA from the IVT was purified using TRIzol first (Ambion ...
-
bioRxiv - Developmental Biology 2021Quote: ... Comparable total RNA quantities were used for reverse transcription with LunaScript RT SuperMix Kit (New England Biolabs). cDNA was amplified with Phusion polymerase for 30-36 cycles and resulting PCR products were separated on a standard 1% agarose gel next to a 100 bp ladder (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: DNA libraries were generated using the NEBNext DNA Library Preparation Kit Ultra II (New England Biolabs, USA). Libraries were generated using 15ul of the ccfNA according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... Site-directed mutagenesis was performed using Q5 Hot Start High Fidelity Kit from New England Biolabs (NEB). Vectors were transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... All Pf-SUMO and Pf-Ubc9 mutants were generated using Q5 Site-Directed Mutagenesis kit (NEB #E0554S) in Pf-SUMO wild type backbone ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cDNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) and cDNA fragments (150 ∼ 200 bp in length ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations were introduced into this construct using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs), and proteins were expressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR fragment and the plasmid (pOPINS3C) were assembled using the NEBuilder HiFi DNA Assembly kit (NEB), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) was used to generate the RNA libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosomal RNA was depleted from 300 ng total RNA using the NEBNext rRNA Depletion Kit (NEB, #E6310L), and libraries were generated for next-generation sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized for qPCR quantification using the LunaScript RT SuperMix Kit (New England Biolabs; Massachusetts, USA). qPCR reactions were composed of 7.5 μL Power SYBR Green PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S; New England Biolabs NEB) according to the manufacturer’s instructions and using primers in the table below ...
-
bioRxiv - Immunology 2021Quote: ... was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S; New England Biolabs NEB) according to the manufacturer’s instructions and using primers in the table below ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1ng of ChIP DNA was taken to prepare library using NEBNext kit for Illumina (New Engand Biolabs) following manufacturer’s instructions and the quality or fragment size was assessed using the Bioanalyser High Sensitivity DNA kit (Agilent) ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: 5ng of purified ChIP DNA was used for library preparation using NEB ultra II DNA kit (NEB) as described in the earlier section ...
-
bioRxiv - Cancer Biology 2021Quote: ... and a first strand library prepared using NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs) and sequenced on a HiSeq 2500 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: Libraries were prepared using the NEBNext Ultra 2 DNA Library Preparation Kit (New England Biolabs, MA, USA) with AMPure® XP Beads (Beckman Coulter ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... These deletions were carried out with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). All proteins were overexpressed in E ...
-
bioRxiv - Developmental Biology 2021Quote: ... and libraries were prepared using the NEBNext Ultra RNA Library Prep kit for Illumina (New England Biolabs). Libraries were subjected to high-throughput sequencing on an Illumina HiSeq 2500 system (150 cycles ...
-
bioRxiv - Biophysics 2020Quote: sgRNAs were produced by in vitro transcription using the HiScribe T7 High Yield RNA synthesis kit (NEB) with PCR amplified gBlocks (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra(tm) DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample.
-
bioRxiv - Cell Biology 2020Quote: ... which was inserted into the L4440 vector backbone using the NEBuilder HiFi DNA assembly cloning kit (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... mRNA enrichment was achieved from 400-900ng of total RNA using a Magnetic mRNA Isolation Kit (NEB). Generation of double stranded cDNA and library construction were performed using NEBNext® mRNA Sample Prep Reagent Set 1 (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... The kinase-dead MELKT167A mutant was constructed using a Q5 site-directed mutagenesis kit (New England Biolabs) with 5′-aggattaccatctacaggcatgctgtgggagtctg-3′ forward and 5′-cagactcccacagcatgcctgtagatggtaatcct-3′ reverse primers.
-
bioRxiv - Genetics 2021Quote: ... the fragments were analyzed by gel electrophoresis and purified using a Monarch DNA Gel Extraction Kit (NEB). All strains had the expected variants in the sequenced fragment ...
-
bioRxiv - Genomics 2020Quote: ... We extracted RNA using Monarch® Total RNA Miniprep Kit (New England BioLabs GmbH, Frankfurt, D, E2010). Material was ground in Mixer Mill 200 (Retsch GmbH ...
-
bioRxiv - Genomics 2020Quote: ... we converted purified mRNA to 300 bp fragment DNA libraries with the Ultra II Directional kit (NEB) and indexed them for multiplexing (NEB).
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from cells with the Monarch Total RNA Miniprep Kit (New England BioLabs, #T2010S) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... total isolated RNA was reverse transcribed using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB), according to the manufacturer’s instructions and using a random primer mix (Promega) ...