Labshake search
Citations for New England Biolabs :
6151 - 6200 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Epidemiology 2019Quote: ... All amplicons were gel purified using the Monarch® DNA Gel Extraction Kit (New England Biolabs, USA) and cloned into pGEM-T vector (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... libraries were prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, USA) and the library preparations were sequenced on an Illumina Hiseq platform (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... and libraries prepared using NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7760). Libraries were sequenced on Illumina HiSeq 1500.
-
bioRxiv - Genomics 2019Quote: Size selection using PAGE gels was recommended by three of the manufacturers (Illumina, NEXTflex, and NEB kits) and was performed for these kits for better comparisons ...
-
bioRxiv - Genomics 2019Quote: ... and libraries were generated using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S). Libraries were sequenced on a NextSeq (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Biochemistry 2019Quote: ... ATG16L1β S269A&S287A were generated by site-directed mutagenesis using Q5® Site-Directed Mutagenesis Kit (NEB). pLKO.1-TRC cloning shRNA vector (addgene ...
-
bioRxiv - Genetics 2020Quote: Barcoded libraries were prepared with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) and the NEBNext rRNA Depletion Kit (NEB #E6310) ...
-
bioRxiv - Systems Biology 2019Quote: ... Libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) according to manufacturer instructions ...
-
bioRxiv - Zoology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-Sequencing libraries were made using NEBNext Ultra II Directional RNA Library Kit for Illumina (NEB #E7760), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.25 μL of reverse transcriptase (M-MuLV Reverse Transcriptase kit from New England Biolabs, CAT# M0253S) was prepared and 3.25 μL of this master mix was added to each of the samples for a total volume of 20 μL ...
-
bioRxiv - Genetics 2020Quote: ... S154 and G184 using a Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs, Ipswich, MA, USA) to remove internal stop codons ...
-
bioRxiv - Biochemistry 2019Quote: ... Point mutants were generated using the protocol from the Q5 Site-Directed Mutagenesis Kit (New England BioLabs), using either the Q5 or Phusion polymerases ...
-
bioRxiv - Immunology 2020Quote: ... ChIP-Seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645) and sequenced by paired-end 75-bp sequencing kit on Illumina NextSeq550.
-
bioRxiv - Cell Biology 2020Quote: ... and reverse-transcribed to cDNA using a Protoscript II First Strand DNA Synthesis kit (New England Biolabs) using random hexamers as primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Library construction was done using the NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP-MyoXΔPH and GFP-MyoXΔFERM were generated with Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S), where the amino acids (1212-1253 ...
-
bioRxiv - Cell Biology 2021Quote: ... Indexed sequencing libraries were generated using the NEBNext Ultra II DNA Library Prep kit (NEB Cat # E7645), pooled and sequenced on an Illumina HiSeq instrument as paired end reads (Novogene ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by strandspecific library prep with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB E7760) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation was done with NEBNext Multiplex Small RNA Library prep kit for Illumina (New England Biolabs) according to the manufactures instructions except for downscaling all samples to half volume and using 30 ng of input RNA (100 ng recommended ...
-
bioRxiv - Systems Biology 2021Quote: ... The RNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on Illumina HiSeq 2 × 150 bp paired-end sequencing (GENEWIZ).
-
bioRxiv - Synthetic Biology 2019Quote: ... The reaction was performed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs). The mixture contained 10 µL of NTP buffer mix ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared with a rRNA-depletion kit (E6310, New England Biolabs Japan, Tokyo, Japan) and a directional library synthesis kit (E6310 ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, USA) and sequenced on an Illumina Hiseq2500 platform (250 bp paired-end reads) ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) including ERCC RNA Spike-in control ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and converted this mRNA to 280-300 bp cDNA fragments using the Ultra II Directional Kit (NEB). Unique sequencing adapters were added to each cDNA library for multiplexing (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs). These samples were sequenced on the high-throughput sequencing platform (HiSeq2500 ...
-
bioRxiv - Immunology 2021Quote: ... sequencing libraries were generated using the NEBNext UltraTM RNA Library Prep Kit for Illumina (New England Biolabs), and the library quality was assessed on the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA sequencing libraries were prepared with NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; E7645) according to the manufacturer’s instructions and quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reversely transcribed using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs #E7765S) as suggested by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... H3 and input) was processed with NEBNext Ultra II DNA Library Prep Kit (New England Biolabs #E7103S) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were generated using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7103, New England Biolabs). The IDT Unique Dual Index adapters and universal primers used were [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC][AGATCGGAAGAGCGTCGTGTAGGGAAAGA GTGT] ...
-
bioRxiv - Microbiology 2021Quote: ... Site directed mutagenesis of plasmids were performed using Q5® Site-Directed Mutagenesis Kit (New England BioLabs) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... and site-specific mutations were introduced into DNA using the Q5 Site-Directed Mutagenesis Kit (NEB, USA) and custom-made primers ...
-
bioRxiv - Molecular Biology 2020Quote: Purified DNA or cDNA was subjected to NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). The DNA was resuspended in 25 μl ddH2O ...
-
bioRxiv - Plant Biology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Prep Kit (New England Biolabs, Ipswitch, MA, USA), and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA sequencing library was generated using NEBNext® Ultra RNA Library Prep Kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Specific DIG-labelled RNA probes were produced using HiScribe Sp6 and T7 in vitro transcription kits (NEB). The sequences of the probes are in the Supplementary Table 5 ...
-
bioRxiv - Immunology 2021Quote: ... The reaction was purified using a PCR clean-up kit according to manufacturer’s directions (NEB, Cat#: T1030S) or using ExoSAP-IT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription of RNA using ProtoScript II First Strand cDNA synthesis kit (New England BioLabs, NE, E6560L) following the manufacturer protocol ...
-
bioRxiv - Genetics 2020Quote: ... DNA libraries were then prepared by PCR amplification using NEBNext High-Fidelity PCR kit (New England Biolabs) in the presence of barcoded PCR primers (sequences provided in Ref ...
-
bioRxiv - Bioengineering 2019Quote: ... and libraries were constructed using an NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770). The libraries were quantified using a Qubit dsDNA HS Kit (ThermoFisher Scientific #Q32854 ...
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... Illumina paired-end libraries were constructed using the Ultra II RNA Directional kit (New England Biolabs, USA) and sequenced with an Illumina HiSeq v4 ...